Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PDGFB cDNA Clone in Mammalian Expression Vector

This is a Platelet Derived Growth Factor Subunit B plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 2800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393687
Supplier Product No.: sc111665
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PDGFB cDNA Clone in Mammalian Expression Vector (ABIN3393687)

Gene

PDGFB (Platelet Derived Growth Factor Subunit B (PDGFB))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111665

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PDGFB is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Elangovan, DMello, Hong, Ross, Allamargot, Dawson, Stanford, Johnson, Sumner, Salem: "The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor." in: Biomaterials, Vol. 35, Issue 2, pp. 737-47, (2013) (PubMed).

    Abramsson, Kurup, Busse, Yamada, Lindblom, Schallmeiner, Stenzel, Sauvaget, Ledin, Ringvall, Landegren, Kjellén, Bondjers, Li, Lindahl, Spillmann, Betsholtz, Gerhardt: "Defective N-sulfation of heparan sulfate proteoglycans limits PDGF-BB binding and pericyte recruitment in vascular development." in: Genes & development, Vol. 21, Issue 3, pp. 316-31, (2007) (PubMed).

  • Target

    PDGFB (Platelet Derived Growth Factor Subunit B (PDGFB))

    Alternative Name

    PDGFB

    Background

    This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015].Transcript Variant: This variant (1) encodes the longer isoform (1) with a signal peptide.

    NCBI Accession

    NM_002608, NP_002599
You are here: