Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PRKCG cDNA Clone in Mammalian Expression Vector

This is a Protein Kinase C, gamma plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 3500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393729
Supplier Product No.: sc112717
$949.41
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PRKCG cDNA Clone in Mammalian Expression Vector (ABIN3393729)

Gene

PKC gamma (PRKCG) (Protein Kinase C, gamma (PRKCG))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc112717

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PRKCG is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shimobayashi, Wagner, Kapfhammer: "Carbonic Anhydrase 8 Expression in Purkinje Cells Is Controlled by PKC? Activity and Regulates Purkinje Cell Dendritic Growth." in: Molecular neurobiology, (2015) (PubMed).

    Ji, Hassler, Shimobayashi, Paka, Streit, Kapfhammer: "Increased protein kinase C gamma activity induces Purkinje cell pathology in a mouse model of spinocerebellar ataxia 14." in: Neurobiology of disease, Vol. 70, pp. 1-11, (2014) (PubMed).

  • Target

    PKC gamma (PRKCG) (Protein Kinase C, gamma (PRKCG))

    Alternative Name

    PRKCG

    Background

    Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015].

    NCBI Accession

    NM_002739, NP_002730
You are here: