Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PTGS2 cDNA Clone in Mammalian Expression Vector

This is a Prostaglandin-Endoperoxide Synthase 2 (Prostaglandin G/H Synthase and Cyclooxygenase) plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 4500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393735
Supplier Product No.: sc128243
$835.56
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PTGS2 cDNA Clone in Mammalian Expression Vector (ABIN3393735)

Gene

PTGS2 (Prostaglandin-Endoperoxide Synthase 2 (Prostaglandin G/H Synthase and Cyclooxygenase) (PTGS2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc128243

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PTGS2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Qian, Yang, Li, Jiang, Song, Yan, Liu, Wu, Kong, Wei, Xiao: "P50-associated COX-2 extragenic RNA (PACER) overexpression promotes proliferation and metastasis of osteosarcoma cells by activating COX-2 gene." in: Tumour biology, Vol. 37, Issue 3, pp. 3879-86, (2016) (PubMed).

    Dudek, Nitzsche, Ludwig, Ehrhardt: "Influenza A viruses suppress cyclooxygenase-2 expression by affecting its mRNA stability." in: Scientific reports, Vol. 6, pp. 27275, (2016) (PubMed).

    Ming, Han, Zhao, Sundaresan, Deng, Gupta, He: "SIRT6 promotes COX-2 expression and acts as an oncogene in skin cancer." in: Cancer research, Vol. 74, Issue 20, pp. 5925-33, (2014) (PubMed).

    Sproviero, Julien, Burford, Taylor-Papadimitriou, Burchell: "Cyclooxygenase-2 enzyme induces the expression of the α-2,3-sialyltransferase-3 (ST3Gal-I) in breast cancer." in: The Journal of biological chemistry, Vol. 287, Issue 53, pp. 44490-7, (2012) (PubMed).

  • Target

    PTGS2 (Prostaglandin-Endoperoxide Synthase 2 (Prostaglandin G/H Synthase and Cyclooxygenase) (PTGS2))

    Alternative Name

    PTGS2

    Background

    Prostaglandin-endoperoxide synthase (PTGS), also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. This gene encodes the inducible isozyme. It is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. [provided by RefSeq, Feb 2009].

    NCBI Accession

    NM_000963, NP_000954
You are here: