Human SP1 cDNA Clone in Mammalian Expression Vector
This is a Sp1 Transcription Factor plasmid from OriGene - 10 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 7000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(10 references)
Catalog No. ABIN3393820
Supplier Product No.: sc101137
$1,068.21
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human SP1 cDNA Clone in Mammalian Expression Vector (ABIN3393820)
Gene
SP1
(Sp1 Transcription Factor (SP1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL6
Promoter
Enhanced CMV Promoter, SP6 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc101137
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SP1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 7000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells." in: Journal of experimental & clinical cancer research : CR, Vol. 34, pp. 154, (2015) (PubMed).
: "Genetic and epigenetic mechanisms collaborate to control SERPINA3 expression and its association with placental diseases." in: Human molecular genetics, Vol. 21, Issue 9, pp. 1968-78, (2012) (PubMed).
: "Coactivator function of positive cofactor 4 (PC4) in Sp1-directed luteinizing hormone receptor (LHR) gene transcription." in: The Journal of biological chemistry, Vol. 286, Issue 9, pp. 7681-91, (2011) (PubMed).
: "The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes." in: Molecular cancer research : MCR, Vol. 8, Issue 7, pp. 975-85, (2010) (PubMed).
: "Regulation of prion gene expression by transcription factors SP1 and metal transcription factor-1." in: The Journal of biological chemistry, Vol. 284, Issue 2, pp. 1291-301, (2009) (PubMed).
: "alpha-Tocopheryl succinate and derivatives mediate the transcriptional repression of androgen receptor in prostate cancer cells by targeting the PP2A-JNK-Sp1-signaling axis." in: Carcinogenesis, Vol. 30, Issue 7, pp. 1125-31, (2009) (PubMed).
: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, (2009) (PubMed).
: "The proinflammatory cytokine, interleukin-6, up-regulates calcium-sensing receptor gene transcription via Stat1/3 and Sp1/3." in: The Journal of biological chemistry, Vol. 283, Issue 20, pp. 13586-600, (2008) (PubMed).
: "Protein kinase Calpha-induced derepression of the human luteinizing hormone receptor gene transcription through ERK-mediated release of HDAC1/Sin3A repressor complex from Sp1 sites." in: Molecular endocrinology (Baltimore, Md.), Vol. 22, Issue 6, pp. 1449-63, (2008) (PubMed).
: "Peroxisome proliferator-activated receptor gamma-independent suppression of androgen receptor expression by troglitazone mechanism and pharmacologic exploitation." in: Cancer research, Vol. 67, Issue 7, pp. 3229-38, (2007) (PubMed).
-
: "Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells." in: Journal of experimental & clinical cancer research : CR, Vol. 34, pp. 154, (2015) (PubMed).
-
- SP1 (Sp1 Transcription Factor (SP1))
-
Alternative Name
- SP1
-
Background
- The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
-
NCBI Accession
- NM_138473, NP_612482
Target
-
You are here:
