Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human E2F1 cDNA Clone in Mammalian Expression Vector

This is a E2F Transcription Factor 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 2000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393977
Supplier Product No.: sc318877
$754.60
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human E2F1 cDNA Clone in Mammalian Expression Vector (ABIN3393977)

Gene

E2F1 (E2F Transcription Factor 1 (E2F1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc318877

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human E2F1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Zhao, Ramos, Demma: "CDK8 regulates E2F1 transcriptional activity through S375 phosphorylation." in: Oncogene, Vol. 32, Issue 30, pp. 3520-30, (2013) (PubMed).

    Yu, Hales: "Silencing of sodium-hydrogen exchanger 1 attenuates the proliferation, hypertrophy, and migration of pulmonary artery smooth muscle cells via E2F1." in: American journal of respiratory cell and molecular biology, Vol. 45, Issue 5, pp. 923-30, (2011) (PubMed).

    Tu, Prajapati, Park, Kelly, Yamamoto, Gaynor: "IKK alpha regulates estrogen-induced cell cycle progression by modulating E2F1 expression." in: The Journal of biological chemistry, Vol. 281, Issue 10, pp. 6699-706, (2006) (PubMed).

  • Target

    E2F1 (E2F Transcription Factor 1 (E2F1))

    Alternative Name

    E2F1

    Background

    The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_005225, NP_005216
You are here: