Human E2F1 cDNA Clone in Mammalian Expression Vector
This is a E2F Transcription Factor 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 2000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3393977
Supplier Product No.: sc318877
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human E2F1 cDNA Clone in Mammalian Expression Vector (ABIN3393977)
Gene
E2F1
(E2F Transcription Factor 1 (E2F1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL6
Promoter
Enhanced CMV Promoter, SP6 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc318877
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human E2F1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "CDK8 regulates E2F1 transcriptional activity through S375 phosphorylation." in: Oncogene, Vol. 32, Issue 30, pp. 3520-30, (2013) (PubMed).
: "Silencing of sodium-hydrogen exchanger 1 attenuates the proliferation, hypertrophy, and migration of pulmonary artery smooth muscle cells via E2F1." in: American journal of respiratory cell and molecular biology, Vol. 45, Issue 5, pp. 923-30, (2011) (PubMed).
: "IKK alpha regulates estrogen-induced cell cycle progression by modulating E2F1 expression." in: The Journal of biological chemistry, Vol. 281, Issue 10, pp. 6699-706, (2006) (PubMed).
-
-
- E2F1 (E2F Transcription Factor 1 (E2F1))
-
Alternative Name
- E2F1
-
Background
- The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_005225, NP_005216
Target
-
You are here:
