Human NOTCH1 cDNA Clone in Mammalian Expression Vector
This is a Notch 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 8100 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3394047
Supplier Product No.: sc308883
$3,133.35
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human NOTCH1 cDNA Clone in Mammalian Expression Vector (ABIN3394047)
Gene
Notch1 (NOTCH1)
(Notch 1 (NOTCH1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL6
Promoter
Enhanced CMV Promoter, SP6 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc308883
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NOTCH1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 8100 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Characterization of FRM-36143 as a new γ-secretase modulator for the potential treatment of familial Alzheimer's disease." in: Alzheimer's research & therapy, Vol. 8, pp. 34, (2016) (PubMed).
: "Directed differentiation of patient-specific induced pluripotent stem cells identifies the transcriptional repression and epigenetic modification of NKX2-5, HAND1, and NOTCH1 in hypoplastic left ..." in: PLoS ONE, Vol. 9, Issue 7, pp. e102796, (2014) (PubMed).
: "Modulation of Notch signaling by antibodies specific for the extracellular negative regulatory region of NOTCH3." in: The Journal of biological chemistry, Vol. 283, Issue 12, pp. 8046-54, (2008) (PubMed).
-
-
- Notch1 (NOTCH1) (Notch 1 (NOTCH1))
-
Alternative Name
- NOTCH1
-
Background
- This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016].
-
NCBI Accession
- NM_017617, NP_060087
Target
-
You are here:
