Human POMC cDNA Clone in Mammalian Expression Vector
This is a Proopiomelanocortin plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 1100 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3394067
Supplier Product No.: sc300157
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 41 to 42 Business Days
Quick Overview for Human POMC cDNA Clone in Mammalian Expression Vector (ABIN3394067)
Gene
POMC
(Proopiomelanocortin (POMC))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL6
Promoter
Enhanced CMV Promoter, SP6 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc300157
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human POMC is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1100 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "A novel missense mutation in the signal peptide of the human POMC gene: a possible additional link between early-onset type 2 diabetes and obesity." in: European journal of human genetics : EJHG, Vol. 20, Issue 12, pp. 1290-4, (2012) (PubMed).
-
: "A novel missense mutation in the signal peptide of the human POMC gene: a possible additional link between early-onset type 2 diabetes and obesity." in: European journal of human genetics : EJHG, Vol. 20, Issue 12, pp. 1290-4, (2012) (PubMed).
-
- POMC (Proopiomelanocortin (POMC))
-
Alternative Name
- POMC
-
Background
- This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used, adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016].Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
-
NCBI Accession
- NM_000939, NP_000930
Target
-
You are here:
