CSPG5 (Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C), CSPG5)

Short Description: The protein encoded by this gene is a proteoglycan that may function as a neural growth and differentiation factor. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011].
More information related to gene CSPG5.
Products related to CSPG5 Gene:
127 Products
Type
  • 121
  • 6
Species
  • 53
  • 39
  • 33
  • 2
Application
  • 81
  • 24
  • 19
  • 16
  • 1
Fusion tag
  • 31
  • 24
  • 19
  • 14
  • 6
Vector Backbone
  • 11
  • 10
  • 10
  • 6
  • 6
Vector
  • 53
  • 41
  • 16
  • 9
  • 1
Insert
  • 46
  • 40
  • 19
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 59
  • 35
  • 26
  • 2
  • 1
Expression Type
  • 108
  • 56
  • 11
Selectable Marker
  • 36
  • 24
  • 11
Promoter
  • 53
  • 31
  • 20
  • 17
  • 8
Format
  • 64
  • 32
  • 25
  • 6

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Gene ID:
505866 (Cow (Bovine), CSPG5)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854611
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_013884
Species:
Mouse (Murine)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887844
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Application:
Quantitative real-time PCR
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C)
Species:
Mouse (Murine)
Synonyms:
CSPG5, cspg5, si:dkeyp-114f9.4, Caleb, Ngc, NGC, CALEB
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195770
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Gene ID:
505866 (Cow (Bovine), CSPG5)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854612
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Gene ID:
10675 (Human, CSPG5)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414504
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_006574
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CSPG5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5116442
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_013884
Species:
Mouse (Murine)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Cspg5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5116444
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_019284
Species:
Rat (Rattus)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Cspg5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5116446
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_001206942,NP_001193871
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Insert length:
1206 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397355
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_001206945,NP_001193874
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Insert length:
1287 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397356
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_001206944,NP_001193873
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Insert length:
1434 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397357
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Application:
RNA Interference
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C)
Species:
Rat (Rattus)
Synonyms:
CSPG5, cspg5, si:dkeyp-114f9.4, Caleb, Ngc, NGC, CALEB
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Cspg5 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3350700
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C)
Species:
Mouse (Murine)
Synonyms:
CSPG5, cspg5, si:dkeyp-114f9.4, Caleb, Ngc, NGC, CALEB
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Cspg5 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3264530
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397350
$460.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397351
$460.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397352
$460.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_006574,NP_006565
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Insert length:
1620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397354
$480.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
NCBI Accession:
NM_001206943,NP_001193872
Species:
Human
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Insert length:
1701 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397358
$480.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C) (CSPG5)
Gene ID:
10675 (Human, CSPG5)
Synonyms:
CSPG5, cspg5a, cspg5b, Cspg5
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5047769

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5028824
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Chondroitin Sulfate Proteoglycan 5 (Neuroglycan C)
Gene ID:
10675 (Human, CSPG5)
Synonyms:
CSPG5, cspg5, si:dkeyp-114f9.4, Caleb, Ngc, NGC, CALEB
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5790371
$511.63
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CSPG5

  • chondroitin sulfate proteoglycan 5 (CSPG5)
  • chondroitin sulfate proteoglycan 5a (cspg5a)
  • chondroitin sulfate proteoglycan 5b (cspg5b)
  • chondroitin sulfate proteoglycan 5 (Cspg5)
  • CALEB
  • Caleb
  • CSPG5
  • cspg5
  • Ngc
  • NGC
  • si:dkeyp-114f9.4

Gene-IDs for different species

GENE IDSPECIES
460336 Pan troglodytes
558206 Danio rerio
559358 Danio rerio
609188 Canis lupus familiaris
711213 Macaca mulatta
29873 Mus musculus
10675 Homo sapiens
505866 Bos taurus
50568 Rattus norvegicus
395466 Gallus gallus

Protein level used designations for CSPG5

  • chondroitin sulfate proteoglycan 5 (neuroglycan C)
  • chondroitin sulfate proteoglycan 5
  • acidic leucine-rich EGF-like domain-containing brain protein
  • neuroglycan C
  • epidermal growth factor
Other products related to CSPG5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com