GDF15 (Growth Differentiation Factor 15, GDF15)

Short Description: Bone morphogenetic proteins (e.g., BMP9\; MIM 605120) are members of the transforming growth factor-beta (see TGFB1\; MIM 190180) superfamily and regulate tissue differentiation and maintenance. They are synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein.[supplied by OMIM, Oct 2009].
More information related to gene GDF15.
Products related to GDF15 Gene:
181 Products
Type
  • 172
  • 9
Species
  • 80
  • 49
  • 28
  • 12
  • 12
Application
  • 104
  • 34
  • 34
  • 30
  • 1
Fusion tag
  • 58
  • 22
  • 21
  • 15
  • 11
Vector Backbone
  • 12
  • 10
  • 9
  • 9
  • 6
Vector
  • 70
  • 55
  • 20
  • 12
  • 10
Insert
  • 63
  • 53
  • 26
  • 16
  • 10
Oligo-Type
  • 8
  • 1
Resistance Gene
  • 83
  • 52
  • 30
  • 7
  • 4
Expression Type
  • 129
  • 76
  • 33
Selectable Marker
  • 40
  • 38
  • 33
  • 1
Promoter
  • 50
  • 46
  • 43
  • 21
  • 16
Format
  • 87
  • 45
  • 37
  • 12

Type:
ORF
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5724415
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Gene ID:
9518 (Human, GDF15)
Synonyms:
GDF15, Gdf15
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088298
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Gene ID:
9518 (Human, GDF15)
Synonyms:
GDF15, Gdf15
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088299
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
NCBI Accession:
XM_541938
Species:
Dog (Canine)
Synonyms:
GDF15, Gdf15
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3560312
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
NCBI Accession:
NM_004864
Species:
Human
Synonyms:
GDF15, Gdf15
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103862
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
NCBI Accession:
XM_001114375
Species:
Rhesus Monkey
Synonyms:
GDF15, Gdf15
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104091
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Growth Differentiation Factor 15
Species:
Human
Synonyms:
GDF15, GDF-15, MIC-1, MIC1, NAG-1, PDF, PLAB, PTGFB, SBF
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189150
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Gene ID:
9518 (Human, GDF15)
Synonyms:
GDF15, Gdf15
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088297
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Gene ID:
9518 (Human, GDF15)
Synonyms:
GDF15, Gdf15
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088300
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Gene ID:
9518 (Human, GDF15)
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313406
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437059
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475964
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767632
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762339
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4565339
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4702909
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Growth Differentiation Factor 15 (GDF15)
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
927 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832039
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Growth Differentiation Factor 15 (GDF15)
Gene ID:
9518 (Human, GDF15)
Synonyms:
GDF15, Gdf15
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3408569
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Growth Differentiation Factor 15 (GDF15)
NCBI Accession:
NM_004864,NP_004855
Species:
Human
Synonyms:
GDF15, Gdf15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317621
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Growth Differentiation Factor 15 (GDF15)
NCBI Accession:
NM_022341,NP_071736
Species:
Human
Synonyms:
GDF15, Gdf15
Insert length:
1156 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3391431
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GDF15

  • growth differentiation factor 15 (GDF15)
  • growth differentiation factor 15 (Gdf15)
  • GDF-15
  • GDF15
  • MIC-1
  • MIC1
  • NAG-1
  • PDF
  • PLAB
  • PTGFB
  • SBF

Gene-IDs for different species

GENE IDSPECIES
719466 Macaca mulatta
9518 Homo sapiens
23886 Mus musculus
29455 Rattus norvegicus
468770 Pan troglodytes
100718010 Cavia porcellus
100379630 Sus scrofa
484822 Canis lupus familiaris
618677 Bos taurus
100913168 Ovis aries

Protein level used designations for GDF15

  • growth differentiation factor 15
  • NRG-1
  • NSAID (nonsteroidal anti-inflammatory drug)-activated protein 1
  • NSAID-activated gene 1 protein
  • NSAID-regulated gene 1 protein
  • PTGF-beta
  • growth/differentiation factor 15
  • macrophage inhibitory cytokine 1
  • placental TGF-beta
  • placental bone morphogenetic protein
  • prostate differentiation factor
  • GDF-15
  • macrophage inhibiting cytokine-1
Other products related to GDF15 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com