gGT2 (gamma-Glutamyltransferase 2, gGT2)

Short Description: Catalyzes the transfer of the gamma-glutamyl moiety of glutathione (GSH) and other gamma-glutamyl compounds to amino acids and peptides. Major GSH-degrading enzyme, catalyzing the hydrolytic release of L-glutamate from GSH. Plays a role in the turnover of the vacuolar GSH, serving as an alternative nitrogen source during nitrogen starvation (By similarity). {ECO:0000250, ECO:0000269|PubMed:15920625}.
More information related to gene gGT2.
Products related to gGT2 Gene:
6 Products
  • 6
  • 6
  • 5
  • 4
  • 1
Fusion tag
  • 5
  • 1
Vector Backbone
  • 2
  • 2
  • 1
  • 1
  • 4
  • 1
  • 1
  • 2
  • 2
  • 1
  • 1
Resistance Gene
  • 5
  • 1
Expression Type
  • 6
  • 5
Selectable Marker
  • 3
  • 2
  • 5
  • 2
  • 2
  • 1
  • 1
  • 4
  • 2

Genome Editing with Engineered Nucleases, Protein Expression
gamma-Glutamyltransferase 2 (gGT2)
NCBI Accession:
GGT2, Reut_A0841, BXE_RS31720, Rxyl_0295, Shewmr7_0609, ggt2c, Aave_0589, ggt2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GGT2
Viral Particles
-80 °C
Catalog No. ABIN5141788
300 μL
Plus shipping costs $45.00 and $22.60 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
gamma-Glutamyltransferase 2 (gGT2)
NCBI Accession:
GGT2, Reut_A0841, BXE_RS31720, Rxyl_0295, Shewmr7_0609, ggt2c, Aave_0589, ggt2
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GGT2
Viral Particles
-80 °C
Catalog No. ABIN5257291
300 μL
Plus shipping costs $45.00 and $22.60 dry ice

Protein Expression
gamma-Glutamyltransferase 2 (gGT2)
NCBI Accession:
GGT2, Reut_A0841, BXE_RS31720, Rxyl_0295, Shewmr7_0609, ggt2c, Aave_0589, ggt2
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3389849
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

RNA Interference
gamma-Glutamyltransferase 2 (gGT2)
GGT2, Reut_A0841, BXE_RS31720, Rxyl_0295, Shewmr7_0609, ggt2c, Aave_0589, ggt2
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
RFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3717284
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
gamma-Glutamyltransferase 2 (gGT2)
NCBI Accession:
GGT2, Reut_A0841, BXE_RS31720, Rxyl_0295, Shewmr7_0609, ggt2c, Aave_0589, ggt2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of GGT2
Viral Particles
-80 °C
Catalog No. ABIN5141787
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
gamma-Glutamyltransferase 2 (gGT2)
NCBI Accession:
GGT2, Reut_A0841, BXE_RS31720, Rxyl_0295, Shewmr7_0609, ggt2c, Aave_0589, ggt2
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of GGT2
Viral Particles
-80 °C
Catalog No. ABIN5257290
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
  • <
  • 1
  • >

Synonyms and alternative names related to gGT2

  • gamma-glutamyltransferase 2 (GGT2)
  • gamma-glutamyltransferase 2 (Reut_A0841)
  • gamma-glutamyltransferase family protein (BXE_RS31720)
  • gamma-glutamyltransferase 2 (Rxyl_0295)
  • gamma-glutamyltransferase 2 (Shewmr7_0609)
  • gamma-glutamyltransferase 2 (ggt2c)
  • gamma-glutamyltransferase 2 (Aave_0589)
  • gamma-glutamyltranspeptidase Ggt2 (ggt2)
  • GGT
  • GGT 2

Gene-IDs for different species

728441 Homo sapiens
3611608 Ralstonia eutropha JMP134
4008461 Burkholderia xenovorans LB400
4117822 Rubrobacter xylanophilus DSM 9941
4257292 Shewanella sp. MR-7
4455217 Ralstonia eutropha H16
4668150 Acidovorax citrulli AAC00-1
2543110 Schizosaccharomyces pombe 972h-

Protein level used designations for gGT2

  • gamma-glutamyltranspeptidase 2
  • glutathione hydrolase 2
  • gamma-glutamyltransferase 2
  • Gamma-glutamyltransferase 2
  • Gamma-glutamyltranspeptidase 2
Other products related to gGT2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website