NBPF12 (Neuroblastoma Breakpoint Family, Member 12, NBPF12)

Products related to NBPF12 Gene:
12 Products
Type
  • 12
Species
  • 12
Application
  • 10
  • 10
Fusion tag
  • 9
  • 2
  • 1
Vector Backbone
  • 4
  • 4
  • 2
  • 2
Vector
  • 10
  • 2
Insert
  • 4
  • 4
  • 2
  • 1
  • 1
Resistance Gene
  • 10
  • 2
  • 2
Expression Type
  • 12
  • 10
Selectable Marker
  • 6
  • 5
Promoter
  • 10
  • 6
  • 4
  • 1
  • 1
Format
  • 9
  • 2
  • 1

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of KIAA1245
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172312
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
NCBI Accession:
XM_001715810
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of NBPF12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172314
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Gene ID:
149013 (Human, NBPF12)
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049912

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030967
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of KIAA1245
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5287907
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
NCBI Accession:
XM_001715810
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of NBPF12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5287909
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of KIAA1245
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172311
$920.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
NCBI Accession:
XM_001715810
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of NBPF12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5172313
$920.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of KIAA1245
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5287906
$1,200.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
NCBI Accession:
XM_001715810
Species:
Human
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of NBPF12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5287908
$1,200.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
NCBI Accession:
NM_001278141,NP_001265070
Species:
Human
Synonyms:
NBPF12
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331841
$1,430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Species:
Human
Synonyms:
NBPF12
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5487564
$1,530.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Neuroblastoma Breakpoint Family, Member 12 (NBPF12)
Gene ID:
149013 (Human, NBPF12)
Synonyms:
NBPF12
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049912

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5049912
$2,603.00
1 set
Plus shipping costs $45.00 and $22.60 dry ice
Delivery in 21 to 26 Business Days
  • <
  • 1
  • >

Synonyms and alternative names related to NBPF12

  • NBPF member 12 (NBPF12)
  • COAS1
  • KIAA1245

Gene-IDs for different species

GENE IDSPECIES
149013 Homo sapiens

Protein level used designations for NBPF12

  • chomosome one amplified sequence 1 cyclophilin
  • chromosome 1 amplified sequence 1
  • neuroblastoma breakpoint family member 12
Other products related to NBPF12 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com