OR5K3 (Olfactory Receptor, Family 5, Subfamily K, Member 3, OR5K3)

Short Description: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008].
More information related to gene OR5K3.
Products related to OR5K3 Gene:
  • 21
  • 1
  • 22
  • 12
  • 7
  • 7
Fusion tag
  • 7
  • 5
  • 4
  • 4
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
  • 13
  • 5
  • 3
  • 7
  • 6
  • 3
  • 2
  • 2
  • 1
Resistance Gene
  • 12
  • 6
  • 3
  • 2
Expression Type
  • 21
  • 14
Selectable Marker
  • 10
  • 5
  • 11
  • 7
  • 4
  • 2
  • 2
  • 12
  • 8
  • 2
22 Products
ISO 9001:2008

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Gene ID:
403277 (Human, OR5K3)
Insert length:
966 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4918725
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR5K3
Viral Particles
-80 °C
Catalog No. ABIN5158745
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Insert length:
966 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5468265
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Olfactory Receptor, Family 5, Subfamily K, Member 3
HPLC purified
Available with shipment
  • OR5K3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3273271
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5468264
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Genome Editing with Engineered Nucleases
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Gene ID:
403277 (Human, OR5K3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5036990
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR5K3
Viral Particles
-80 °C
Catalog No. ABIN5274325
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3303484
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Insert length:
966 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5468267
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

RNA Interference
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Gene ID:
403277 (Human, OR5K3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN4198547
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
RFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3715271
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3735610
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3652707
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Insert length:
966 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5468266
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

RNA Interference
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3755948
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of OR5K3
Viral Particles
-80 °C
Catalog No. ABIN5158744
3 x 300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Lentiviral particles with guaranteed titer of >10^7 TU/mL
Viral Particles
-80 °C
Catalog No. ABIN6424331
200 μL
Plus shipping costs $45.00 and $24.00 dry ice
Delivery in 25 to 30 Business Days

Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag

Lentiviral particles with guaranteed titer of >10^7 TU/mL
Viral Particles
-80 °C
Catalog No. ABIN6424332
200 μL
Plus shipping costs $45.00 and $24.00 dry ice
Delivery in 25 to 30 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • OR5K3 gRNA vector 1 in pCAS-Guide vector.
  • OR5K3 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
-20 °C
Catalog No. ABIN3229253
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Olfactory Receptor, Family 5, Subfamily K, Member 3 (OR5K3)
NCBI Accession:
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of OR5K3
Viral Particles
-80 °C
Catalog No. ABIN5274324
3 x 300 μL
Plus shipping costs $45.00 and $24.00 dry ice
  • <
  • 1

Synonyms and alternative names related to OR5K3

  • olfactory receptor family 5 subfamily K member 3 (OR5K3)

Gene-IDs for different species

403277 Homo sapiens

Protein level used designations for OR5K3

  • olfactory receptor 5K3
Other products related to OR5K3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com