PDGFRB (Platelet-Derived Growth Factor Receptor, beta Polypeptide, PDGFRB)

Short Description: This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor\; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008].
More information related to gene PDGFRB.
Products related to PDGFRB Gene:
146 Products
Data Quality
  • 2
Type
  • 140
  • 6
Species
  • 50
  • 43
  • 39
  • 12
  • 2
Application
  • 95
  • 26
  • 25
  • 20
  • 2
Fusion tag
  • 42
  • 18
  • 18
  • 12
  • 10
Vector Backbone
  • 8
  • 8
  • 8
  • 8
  • 6
Vector
  • 64
  • 43
  • 16
  • 9
  • 3
Insert
  • 56
  • 43
  • 21
  • 10
  • 8
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 73
  • 44
  • 22
  • 2
  • 1
Expression Type
  • 101
  • 57
  • 33
Selectable Marker
  • 33
  • 30
  • 28
Promoter
  • 41
  • 39
  • 35
  • 17
  • 10
Format
  • 74
  • 32
  • 28
  • 12

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_002609,NP_002600
Species:
Human
Synonyms:
Pdgfrb, PDGFRB
Insert length:
3321 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5423516
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_002609
Gene ID:
5159 (Human, PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Insert length:
3321 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4936739
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
5159 (Human, PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804857
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
527165 (Cow (Bovine), PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063717
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
18596 (Mouse (Murine), PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096570
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
XM_001107595
Species:
Rhesus Monkey
Synonyms:
Pdgfrb, PDGFRB
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627809
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_002609
Species:
Human
Synonyms:
Pdgfrb, PDGFRB
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627810
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_031525
Species:
Rat (Rattus)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627811
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide
Species:
Human
Synonyms:
AI528809, CD140b, PDGFR-1, Pdgfr, CD140B, IBGC4, JTK12, PDGFR, PDGFR1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188869
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide
Species:
Rat (Rattus)
Synonyms:
AI528809, CD140b, PDGFR-1, Pdgfr, CD140B, IBGC4, JTK12, PDGFR, PDGFR1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196481
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
5159 (Human, PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804858
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
527165 (Cow (Bovine), PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063718
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
18596 (Mouse (Murine), PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096569
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
5159 (Human, PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Insert length:
3321 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318768
$218.77
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
5159 (Human, PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3419962
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
Gene ID:
5159 (Human, PDGFRB)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3425090
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
XM_001107595
Species:
Rhesus Monkey
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627776
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_002609
Species:
Human
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627777
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_031525
Species:
Rat (Rattus)
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627778
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Platelet-Derived Growth Factor Receptor, beta Polypeptide (PDGFRB)
NCBI Accession:
NM_002609
Species:
Human
Synonyms:
Pdgfrb, PDGFRB
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3627783
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1

Synonyms and alternative names related to PDGFRB

  • platelet derived growth factor receptor, beta polypeptide (Pdgfrb)
  • platelet derived growth factor receptor beta (Pdgfrb)
  • platelet derived growth factor receptor beta (PDGFRB)
  • AI528809
  • CD140b
  • CD140B
  • IBGC4
  • JTK12
  • Pdgfr
  • PDGFR
  • PDGFR-1
  • PDGFR1

Gene-IDs for different species

GENE IDSPECIES
18596 Mus musculus
24629 Rattus norvegicus
5159 Homo sapiens
442985 Canis lupus familiaris
770488 Gallus gallus
100342872 Oryctolagus cuniculus

Protein level used designations for PDGFRB

  • CD140 antigen-like family member B
  • PDGF beta chain
  • PDGF-R-beta
  • PDGFR-beta
  • beta platelet-derived growth factor receptor
  • beta-type platelet-derived growth factor receptor
  • platelet-derived growth factor receptor 1
  • platelet-derived growth factor receptor beta
  • platelet-derived growth factor receptor beta variant 1
  • Platelet-derived growth factor receptor, beta
  • protein tyrosin kinase
Other products related to PDGFRB such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com