PPARGC1B (Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta, PPARGC1B)

Short Description: The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010].
More information related to gene PPARGC1B.
Products related to PPARGC1B Gene:
98 Products
Data Quality
  • 1
Type
  • 94
  • 4
Species
  • 48
  • 26
  • 24
Application
  • 49
  • 25
  • 20
  • 16
Fusion tag
  • 32
  • 17
  • 11
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 33
  • 32
  • 12
  • 9
  • 8
Insert
  • 37
  • 21
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 42
  • 36
  • 16
  • 2
Expression Type
  • 86
  • 53
Selectable Marker
  • 37
  • 26
Promoter
  • 35
  • 31
  • 15
  • 8
  • 7
Format
  • 46
  • 24
  • 16
  • 12

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
170826 (Mouse (Murine), PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4012217
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011420
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011422
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011421
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
170826 (Mouse (Murine), PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4012216
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011423
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011424
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011425
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
NCBI Accession:
NM_133249
Species:
Mouse (Murine)
Synonyms:
PPARGC1B, Ppargc1b
Insert length:
3045 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4453284
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
NCBI Accession:
NM_001172698,NP_001166169
Species:
Human
Synonyms:
PPARGC1B, Ppargc1b
Insert length:
2955 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5406355
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 36 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
NCBI Accession:
NM_133263
Species:
Human
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of PPARGC1B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5121458
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
NCBI Accession:
NM_133249
Species:
Mouse (Murine)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ppargc1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5121460
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
NCBI Accession:
NM_176075
Species:
Rat (Rattus)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ppargc1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5121462
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta
Species:
Human
Synonyms:
PPARGC1B, 4631412G21Rik, Perc, PGC1beta, ERRL1, PERC, PGC-1(beta), PGC1B
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • PPARGC1B (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312185
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta
Species:
Mouse (Murine)
Synonyms:
PPARGC1B, 4631412G21Rik, Perc, PGC1beta, ERRL1, PERC, PGC-1(beta), PGC1B
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ppargc1b (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3348575
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta
Species:
Rat (Rattus)
Synonyms:
PPARGC1B, 4631412G21Rik, Perc, PGC1beta, ERRL1, PERC, PGC-1(beta), PGC1B
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ppargc1b (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3358417
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Species:
Human
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5406352
$460.00
10 μg
Plus shipping costs $45.00
Will be delivered in 36 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049294

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030349
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta
Gene ID:
133522 (Human, PPARGC1B)
Synonyms:
PPARGC1B, 4631412G21Rik, Perc, PGC1beta, ERRL1, PERC, PGC-1(beta), PGC1B
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5792092
$511.63
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Peroxisome Proliferator-Activated Receptor Gamma, Coactivator 1 beta (PPARGC1B)
NCBI Accession:
NM_133263
Species:
Human
Synonyms:
PPARGC1B, Ppargc1b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of PPARGC1B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5236833
$520.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to PPARGC1B

  • PPARG coactivator 1 beta (PPARGC1B)
  • peroxisome proliferative activated receptor, gamma, coactivator 1 beta (Ppargc1b)
  • PPARG coactivator 1 beta (Ppargc1b)
  • 4631412G21Rik
  • ERRL1
  • Perc
  • PERC
  • PGC-1(beta)
  • PGC1B
  • PGC1beta
  • PPARGC1B

Gene-IDs for different species

GENE IDSPECIES
416148 Gallus gallus
489190 Canis lupus familiaris
100387198 Callithrix jacchus
100458162 Pongo abelii
100476461 Ailuropoda melanoleuca
100590413 Nomascus leucogenys
170826 Mus musculus
291567 Rattus norvegicus
133522 Homo sapiens

Protein level used designations for PPARGC1B

  • peroxisome proliferator-activated receptor gamma, coactivator 1 beta
  • peroxisome proliferator-activated receptor gamma coactivator 1-beta-like
  • ERR ligand 1
  • PGC-1-beta
  • PGC-1beta
  • PGC-1beta/ERRL1
  • PPAR gamma coactivator-1beta protein
  • PPAR-gamma coactivator 1-beta
  • PPARGC-1-beta
  • peroxisome proliferator-activated receptor gamma coactivator 1 beta
  • peroxisome proliferator-activated receptor gamma coactivator 1-beta
  • peroxisome proliferative activated receptor, gamma, coactivator 1 beta
  • peroxisome proliferator-activated receptor gamma coactivator 1beta-2a
  • PGC-1-related estrogen receptor alpha coactivator
Other products related to PPARGC1B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com