Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MBP cDNA Clone in Mammalian Expression Vector

This is a Myelin Basic Protein plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385050
Supplier Product No.: sc302342
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MBP cDNA Clone in Mammalian Expression Vector (ABIN3385050)

Gene

MBP (Myelin Basic Protein (MBP))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc302342

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MBP is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    MBP (Myelin Basic Protein (MBP))

    Alternative Name

    Myelin basic protein

    Background

    The protein encoded by the classic MBP gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, MBP-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long MBP gene (otherwise called 'Golli-MBP') that contains 3 additional exons located upstream of the classic MBP exons. Alternative splicing from the Golli and the MBP transcription start sites gives rise to 2 sets of MBP-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-MBP, spliced in-frame to 1 or more MBP exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to MBP aa sequence. The second family of transcripts contain only MBP exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the MBP transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) encodes the longest of the classic MBP isoforms (1).

    NCBI Accession

    NM_001025081, NP_001020252
You are here: