Human MBP cDNA Clone in Mammalian Expression Vector
Quick Overview for Human MBP cDNA Clone in Mammalian Expression Vector (ABIN3385051)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc302343
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human MBP is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2300 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human MBP cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- MBP (Myelin Basic Protein (MBP))
-
Alternative Name
- Myelin basic protein
-
Background
- The protein encoded by the classic MBP gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, MBP-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long MBP gene (otherwise called 'Golli-MBP') that contains 3 additional exons located upstream of the classic MBP exons. Alternative splicing from the Golli and the MBP transcription start sites gives rise to 2 sets of MBP-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-MBP, spliced in-frame to 1 or more MBP exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to MBP aa sequence. The second family of transcripts contain only MBP exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the MBP transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3) lacks exon 2 compared to transcript variant 1 and encodes one of the classic MBP isoforms (3) that is missing a 26 aa segment compared to isoform 1.
-
NCBI Accession
- NM_001025090, NP_001020261
Target
-
