Plasmids

Type
  • 1
    Plasmid
Application
  • 1
  • 1
Fusion tag
  • 1
Vector Backbone
  • 1
Vector
  • 1
Insert
  • 1
Resistance Gene
  • 1
Expression Type
  • 1
  • 1
Selectable Marker
  • 1
Promoter
  • 1
Format
  • 1
1 Product

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948170
$197.35
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1
  • >