Plasmids

1 Product
Type
  • 1
    Plasmid
Application
  • 1
  • 1
Vector Backbone
  • 1
Vector
  • 1
Insert
  • 1
Resistance Gene
  • 1
Expression Type
  • 1
Selectable Marker
  • 1
Promoter
  • 1
Format
  • 1
Supplier: Log in to see

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948181
$550.00
10 μg
Plus shipping costs $45.00
Will be delivered in 11 Business Days
  • <
  • 1
  • >