Search Results for "Coronavirus"

Data Quality
  • 1
  • 1
Type
  • 157
  • 1
Gene
  • 14
  • 14
  • 14
  • 14
  • 14
Species
  • 114
  • 30
  • 12
  • 1
  • 1
Application
  • 146
  • 11
  • 1
Fusion tag
  • 27
  • 24
  • 23
  • 22
  • 22
Vector Backbone
  • 12
  • 12
  • 12
  • 12
  • 11
Vector
  • 146
  • 11
Insert
  • 146
  • 11
Resistance Gene
  • 131
  • 26
Expression Type
  • 146
Selectable Marker
  • 146
Promoter
  • 146
Format
  • 157
Suggested next Filters
158 Products

Type:
ORF
Application:
Protein Expression
Gene:
Coronavirus Spike Glycoprotein (CoV S)
Species:
Human Coronavirus (HCoV)
Synonyms:
S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3591684
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931678
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931680
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931681
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931684
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931682
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931685
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931686
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931687
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948176

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931679
$608.82
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-OFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
OFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948175

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931683
$608.82
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3931688
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Dromedary camel Coronavirus Spike Protein (DcCoV S)
Species:
Dromedary camel Coronavirus (DcCoV)
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104022
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Catalog No. ABIN6952468
$500.50
Plus shipping costs $45.00
Delivery in 2 to 3 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SARS-Coronavirus Nonstructural Protein 3 (SARS-CoV NSP3)
Species:
SARS Coronavirus (SARS-CoV)
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563579
$161.76
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SARS-Coronavirus Nonstructural Protein 8 (SARS-CoV NSP8)
Species:
SARS Coronavirus (SARS-CoV)
Synonyms:
orf1ab
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545804
$161.76
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
SARS-Coronavirus Spike Protein (SARS-CoV S)
Species:
SARS Coronavirus (SARS-CoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Publications
  • Chunyun Sun, Long Chen, Ji Yang, Chunxia Luo, Yanjing Zhang, Jing Li, Jiahui Yang, Jie Zhang, Liangzhi Xie: "SARS-CoV-2 and SARS-CoV Spike-RBD Structure and Receptor Binding Comparison and Potential Implications on Neutralizing Antibody and Vaccine Development" in: bioRxiv, Vol. , Issue , pp. , 2020 (Pubmed)
Catalog No. ABIN3591686
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
MERS-Coronavirus Spike Protein (MERS-CoV S)
Species:
Middle East Respiratory Syndrome Coronavirus (MERS-CoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3591687
$573.53
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
MERS-Coronavirus Spike Protein (MERS-CoV S)
Species:
Middle East Respiratory Syndrome Coronavirus (MERS-CoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948176

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3591688
$608.82
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SARS-Coronavirus Nonstructural Protein 3 (SARS-CoV NSP3)
Species:
SARS Coronavirus (SARS-CoV)
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3632324
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1