ABRA (Actin-Binding rho Activating Protein, ABRA)

Short Description: Acts as an activator of serum response factor (SRF)- dependent transcription possibly by inducing nuclear translocation of MKL1 or MKL2 and through a mechanism requiring Rho-actin signaling (By similarity).
More information related to gene ABRA.
Products related to ABRA Gene:
104 Products
Type
  • 98
  • 6
Species
  • 38
  • 32
  • 30
  • 2
  • 2
Oligo-Type
  • 6
Insert
  • 41
  • 21
  • 20
  • 8
  • 6
Vector
  • 35
  • 30
  • 12
  • 11
  • 9
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 42
  • 16
  • 10
  • 9
  • 8
Resistance Gene
  • 42
  • 35
  • 18
  • 3
  • 2
Selectable Marker
  • 33
  • 26
Promoter
  • 31
  • 31
  • 13
  • 11
  • 8
Expression Type
  • 89
  • 49
  • 2
Application
  • 50
  • 29
  • 27
  • 16
Format
  • 36
  • 27
  • 22
  • 19
Supplier: Log in to see

Full length Danio rerio actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
445477 (Zebrafish (Danio rerio), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058290
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
286965 (Rat (Rattus), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049310
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
223513 (Mouse (Murine), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013297
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
223513 (Mouse (Murine), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013298
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
137735 (Human, ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011515
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
137735 (Human, ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011516
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
445477 (Zebrafish (Danio rerio), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058291
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
286965 (Rat (Rattus), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049311
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
223513 (Mouse (Murine), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013296
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
223513 (Mouse (Murine), ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013295
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
137735 (Human, ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011513
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens actin-binding Rho activating protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
137735 (Human, ABRA)
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011514
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The actin-binding Rho activating protein ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Actin-Binding rho Activating Protein (ABRA)
Gene ID:
137735 (Human, ABRA)
Synonyms:
ABRA, Abra
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR201
Resistance Gene:
Kanamycin

Sequencing Primer:
  • pDONR201-forward
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407615
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Actin-Binding rho Activating Protein (ABRA)
NCBI Accession:
NM_139166
Species:
Human
Synonyms:
ABRA, Abra
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5764289
$350.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Actin-Binding rho Activating Protein
Species:
Mouse (Murine)
Synonyms:
STARS, C130068O12Rik, Ms1, Stars
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abra (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3268730
$390.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Actin-Binding rho Activating Protein
Species:
Human
Synonyms:
STARS, C130068O12Rik, Ms1, Stars
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABRA (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312271
$390.00
1 kit
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Actin-Binding rho Activating Protein
Species:
Rat (Rattus)
Synonyms:
STARS, C130068O12Rik, Ms1, Stars
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abra (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355733
$390.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Abra is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Actin-Binding rho Activating Protein (ABRA)
NCBI Accession:
NM_175844,NP_787038
Species:
Rat (Rattus)
Synonyms:
ABRA, Abra
Insert length:
1128 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308448
$390.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Abra is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Actin-Binding rho Activating Protein (ABRA)
NCBI Accession:
NM_175456,NP_780665
Species:
Mouse (Murine)
Synonyms:
ABRA, Abra
Insert length:
1128 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308447
$390.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Individual gRNA against ABRA in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin-Binding rho Activating Protein (ABRA)
NCBI Accession:
NM_139166
Species:
Human
Synonyms:
ABRA, Abra
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABRA
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5165030
$395.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ABRA

  • actin binding Rho activating protein (ABRA)
  • actin-binding Rho activating protein (Abra)
  • C130068O12Rik
  • Ms1
  • STARS
  • Stars

Gene-IDs for different species

GENE IDSPECIES
137735 Homo sapiens
223513 Mus musculus
286965 Rattus norvegicus
100154546 Sus scrofa

Protein level used designations for ABRA

  • actin-binding Rho-activating protein
  • striated muscle activator of Rho-dependent signaling
  • MS1
Other products related to ABRA such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com