AES (Amino-terminal Enhancer of Split, AES)

Short Description: The protein encoded by this gene is similar in sequence to the amino terminus of Drosophila enhancer of split groucho, a protein involved in neurogenesis during embryonic development. The encoded protein, which belongs to the groucho/TLE family of proteins, can function as a homooligomer or as a heteroologimer with other family members to dominantly repress the expression of other family member genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene AES.
Products related to AES Gene:
143 Products
Data Quality
  • 1
Type
  • 136
  • 7
Species
  • 53
  • 50
  • 30
  • 4
  • 2
Application
  • 84
  • 39
  • 27
  • 16
  • 1
Fusion tag
  • 56
  • 21
  • 15
  • 11
  • 8
Vector Backbone
  • 10
  • 9
  • 9
  • 8
  • 7
Vector
  • 57
  • 42
  • 13
  • 12
  • 9
Insert
  • 52
  • 47
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 57
  • 50
  • 24
  • 5
  • 2
Expression Type
  • 110
  • 54
  • 13
  • 2
Selectable Marker
  • 41
  • 26
  • 13
  • 1
Promoter
  • 43
  • 33
  • 31
  • 13
  • 8
Format
  • 64
  • 28
  • 27
  • 24
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Amino-terminal Enhancer of Split (AES)
NCBI Accession:
NM_001130,NP_001121
Species:
Human
Synonyms:
AES, Aes, aes, aes.S
Insert length:
594 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5335161
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Amino-terminal Enhancer of Split (AES)
NCBI Accession:
NM_198970,NP_945321
Species:
Human
Synonyms:
AES, Aes, aes, aes.S
Insert length:
591 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5335162
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
393395 (Zebrafish (Danio rerio), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877516
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
14797 (Mouse (Murine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002501
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
14797 (Mouse (Murine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002502
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
733921 (Xenopus tropicalis, AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031044
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
166 (Human, AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998364
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
14797 (Mouse (Murine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002500
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
398976 (Xenopus laevis, AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846378
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
505375 (Cow (Bovine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854359
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
29466 (Rat (Rattus), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879156
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
733921 (Xenopus tropicalis, AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3868332
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
166 (Human, AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998363
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
NCBI Accession:
NM_010347
Species:
Mouse (Murine)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3555977
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Amino-terminal Enhancer of Split
Species:
Mouse (Murine)
Synonyms:
AES-1, AES-2, ESP1, GRG, GRG5, TLE5, AL024115, Esp1, Grg, Grg-5, Grg5, Tle5, zgc:64216, aes-1, aes-2, esp1, grg, grg5, tle5, xgrg-5, AES
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195602
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
393395 (Zebrafish (Danio rerio), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844896
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
14797 (Mouse (Murine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002498
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
14797 (Mouse (Murine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002499
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
733921 (Xenopus tropicalis, AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031043
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Amino-terminal Enhancer of Split (AES)
Gene ID:
14797 (Mouse (Murine), AES)
Synonyms:
AES, Aes, aes, aes.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002497
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to AES

  • amino-terminal enhancer of split (AES)
  • amino-terminal enhancer of split (Aes)
  • amino-terminal enhancer of split (aes)
  • amino-terminal enhancer of split S homeolog (aes.S)
  • AES
  • aes-1
  • AES-1
  • aes-2
  • AES-2
  • AL024115
  • Esp1
  • esp1
  • ESP1
  • GRG
  • Grg
  • grg
  • Grg-5
  • grg5
  • Grg5
  • GRG5
  • Tle5
  • TLE5
  • tle5
  • xgrg-5
  • zgc:64216

Gene-IDs for different species

GENE IDSPECIES
166 Homo sapiens
14797 Mus musculus
29466 Rattus norvegicus
505375 Bos taurus
393395 Danio rerio
398976 Xenopus laevis
485064 Canis lupus familiaris
733921 Xenopus (Silurana) tropicalis
744806 Pan troglodytes
101788509 Cavia porcellus
100858542 Gallus gallus

Protein level used designations for AES

  • gp130-associated protein GAM
  • related to Drosophila groucho
  • R-esp1
  • amino enhancer of split
  • amino enhancer split
  • amino-terminal enhancer of split
  • transducin-like enhancer of split 4 homolog of Drosophila E(spl)
Other products related to AES such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com