AGAP6 (ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6, AGAP6)

Short Description: Putative GTPase-activating protein (Potential).
More information related to gene AGAP6.
Products related to AGAP6 Gene:
23 Products
Type
  • 21
  • 2
Species
  • 23
Application
  • 11
  • 9
  • 7
Fusion tag
  • 8
  • 6
  • 4
  • 4
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
Vector
  • 13
  • 5
  • 3
Insert
  • 7
  • 6
  • 3
  • 2
  • 2
Oligo-Type
  • 2
Resistance Gene
  • 11
  • 6
  • 4
  • 2
Expression Type
  • 21
  • 14
Selectable Marker
  • 10
  • 5
Promoter
  • 12
  • 7
  • 4
  • 2
  • 2
Format
  • 13
  • 8
  • 2
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665
Species:
Human
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AGAP6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171112
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6
Species:
Human
Synonyms:
CTGLF3, bA324H6.1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AGAP6 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3273309
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665,NP_001071133
Species:
Human
Synonyms:
AGAP6
Insert length:
2061 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486064
$430.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6
Gene ID:
414189 (Human, AGAP6)
Synonyms:
CTGLF3, bA324H6.1
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5802924
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Gene ID:
414189 (Human, AGAP6)
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5056068

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5037123
$495.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665
Species:
Human
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AGAP6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5286707
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Gene ID:
414189 (Human, AGAP6)
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4199060

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4199059
$695.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Gene ID:
414189 (Human, AGAP6)
Synonyms:
AGAP6
Vector type:
Mammalian Expression Vector
Vector backbone:
pU6-GFP-Neo
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter, U6 Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
This product contains 3 separate slightly different shRNA sequences which knock down human AGAP6 gene specifically. Each vial contains 50 μg of lyophilized shRNA.
Format:
Lyophilized
Storage:
4 °C,-20 °C,-80 °C
Catalog No. ABIN5842497
$749.44
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3724271
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948189

Components:
  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3661706
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948187

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3744609
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Vector backbone:
pGFP-C-shLenti
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948186

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3764947
$815.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665
Species:
Human
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of AGAP6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171111
$920.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665
Species:
Human
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of AGAP6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5286706
$1,200.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486063
$1,190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • AGAP6 gRNA vector 1 in pCAS-Guide vector.
  • AGAP6 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3245595
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665,NP_001071133
Species:
Human
Synonyms:
AGAP6
Insert length:
2061 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486066
$1,260.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665,NP_001071133
Species:
Human
Synonyms:
AGAP6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320705
$1,360.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
NCBI Accession:
NM_001077665,NP_001071133
Species:
Human
Synonyms:
AGAP6
Insert length:
2061 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486065
$1,390.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with GTPase Domain, Ankyrin Repeat and PH Domain 6 (AGAP6)
Species:
Human
Synonyms:
AGAP6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
Lentiviral particles with guaranteed titer of >10^7 TU/mL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN6424233
$1,748.53
200 μL
Plus shipping costs $45.00 and $22.60 dry ice
Delivery in 25 to 30 Business Days
  • <
  • 1

Synonyms and alternative names related to AGAP6

  • ArfGAP with GTPase domain, ankyrin repeat and PH domain 6 (AGAP6)
  • bA324H6.1
  • CTGLF3

Gene-IDs for different species

GENE IDSPECIES
414189 Homo sapiens

Protein level used designations for AGAP6

  • AGAP-6
  • arf-GAP with GTPase, ANK repeat and PH domain-containing protein 6
  • centaurin, gamma-like family, member 3
  • centaurin-gamma-like family member 3
Other products related to AGAP6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com