beta Synuclein (Synuclein, beta, SNCB)

Short Description: The protein encoded by this gene is highly homologous to alpha-synuclein. These proteins are abundantly expressed in the brain and putatively inhibit phospholipase D2 selectively. The encoded protein, which may play a role in neuronal plasticity, is abundant in neurofibrillary lesions of patients with Alzheimer disease. This protein has been shown to be highly expressed in the substantia nigra of the brain, a region of neuronal degeneration in patients with Parkinson disease\; however, no direct relation to Parkinson disease has been established. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene beta Synuclein.
Products related to beta Synuclein Gene:
Type
  • 116
  • 4
Species
  • 57
  • 27
  • 26
  • 4
  • 2
Application
  • 76
  • 32
  • 19
  • 16
  • 1
Fusion tag
  • 45
  • 16
  • 13
  • 11
  • 6
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 5
Vector
  • 48
  • 37
  • 12
  • 9
  • 7
Insert
  • 44
  • 40
  • 16
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 46
  • 43
  • 24
  • 3
  • 2
Expression Type
  • 96
  • 45
  • 13
Selectable Marker
  • 25
  • 24
  • 13
Promoter
  • 34
  • 28
  • 28
  • 13
  • 8
Format
  • 49
  • 27
  • 23
  • 21
120 Products

Type:
ORF
Application:
Protein Expression
Gene:
Synuclein, beta (SNCB)
NCBI Accession:
NM_003085,NP_003076
Species:
Human
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Insert length:
405 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5340018
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Synuclein, beta (SNCB)
NCBI Accession:
NM_001001502,NP_001001502
Species:
Human
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Insert length:
405 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5340019
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
393944 (Zebrafish (Danio rerio), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018977
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
104069 (Mouse (Murine), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3829853
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
508421 (Cow (Bovine), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855870
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
394467 (Xenopus tropicalis, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881259
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
495448 (Xenopus laevis, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983225
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
113893 (Rat (Rattus), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047759
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
6620 (Human, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086869
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Synuclein, beta (SNCB)
NCBI Accession:
NM_001001502
Species:
Human
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565207
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Synuclein, beta
Species:
Human
Synonyms:
AI838531, betaSYN, zgc:66343, sncb, MGC75784, LOC619281, SNCB, syub
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189599
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
393944 (Zebrafish (Danio rerio), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018978
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
104069 (Mouse (Murine), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3829852
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
508421 (Cow (Bovine), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855871
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
394467 (Xenopus tropicalis, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881260
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
495448 (Xenopus laevis, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983226
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
113893 (Rat (Rattus), SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047760
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Synuclein, beta (SNCB)
Gene ID:
6620 (Human, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086868
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Synuclein, beta (SNCB)
Gene ID:
6620 (Human, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3424053
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Synuclein, beta (SNCB)
Gene ID:
6620 (Human, SNCB)
Synonyms:
SNCB, Sncb, sncb, sncb.L, syub
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3420807
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to beta Synuclein

  • synuclein beta (SNCB)
  • synuclein, beta (Sncb)
  • synuclein, beta (sncb)
  • synuclein beta (sncb)
  • synuclein beta L homeolog (sncb.L)
  • Beta-synuclein (syub)
  • AI838531
  • betaSYN
  • LOC619281
  • MGC75784
  • sncb
  • SNCB
  • syub
  • zgc:66343

Gene-IDs for different species

GENE IDSPECIES
6620 Homo sapiens
104069 Mus musculus
113893 Rattus norvegicus
393944 Danio rerio
394467 Xenopus (Silurana) tropicalis
395391 Gallus gallus
479279 Canis lupus familiaris
495448 Xenopus laevis
508421 Bos taurus
619281 Takifugu rubripes
697484 Macaca mulatta
736255 Pan troglodytes
100127169 Sus scrofa
100190189 Taeniopygia guttata
100196630 Salmo salar
100354265 Oryctolagus cuniculus

Protein level used designations for beta Synuclein

  • beta-synuclein
  • PNP 14
  • phosphoneuroprotein 14
  • zSyn-&beta
  • zSynC
  • synuclein, beta
  • putative beta-synuclein variant 1
  • Beta-synuclein
Other products related to beta Synuclein such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com