BID (BH3 Interacting Domain Death Agonist, BID)

Short Description: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8)\; CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008].
More information related to gene BID.
Products related to BID Gene:
Data Quality
  • 1
Type
  • 163
  • 5
Species
  • 94
  • 42
  • 26
  • 4
  • 2
Application
  • 107
  • 40
  • 21
  • 16
  • 2
Fusion tag
  • 54
  • 21
  • 18
  • 16
  • 8
Vector Backbone
  • 9
  • 8
  • 8
  • 7
  • 6
Vector
  • 75
  • 40
  • 18
  • 12
  • 9
Insert
  • 72
  • 57
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 73
  • 56
  • 24
  • 10
  • 2
Expression Type
  • 120
  • 63
  • 26
Selectable Marker
  • 41
  • 26
  • 26
  • 1
Promoter
  • 52
  • 40
  • 28
  • 21
  • 8
Format
  • 82
  • 40
  • 24
  • 22
168 Products

Type:
ORF
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Species:
Human
Synonyms:
BID, Bid, bida, bid.S, bid
Insert length:
588 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5721285
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Species:
Human
Synonyms:
BID, Bid, bida, bid.S, bid
Insert length:
588 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5721286
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
BH3 Interacting Domain Death Agonist (BID)
NCBI Accession:
NM_001196,NP_001187
Species:
Human
Synonyms:
BID, Bid, bida, bid.S, bid
Insert length:
588 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5339598
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
BH3 Interacting Domain Death Agonist (BID)
NCBI Accession:
NM_197967
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Insert length:
300 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4920556
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
BH3 Interacting Domain Death Agonist (BID)
NCBI Accession:
NM_001196
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Insert length:
588 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4920557
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
559425 (Zebrafish (Danio rerio), BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023121
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
559425 (Zebrafish (Danio rerio), BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023122
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471081
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083384
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210795
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
510373 (Cow, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856847
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
12122 (Mouse, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462845
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
NCBI Accession:
NM_001196
Species:
Human
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886387
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
NCBI Accession:
NM_007544
Species:
Mouse
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103771
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
BH3 Interacting Domain Death Agonist
Species:
Human
Synonyms:
FP497, 2700049M22Rik, AI875481, AU022477, BID, bid, si:ch211-238n5.6, fp497, xbid, DKFZp469E066
PCR Size:
96 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188377
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
BH3 Interacting Domain Death Agonist
Species:
Mouse
Synonyms:
FP497, 2700049M22Rik, AI875481, AU022477, BID, bid, si:ch211-238n5.6, fp497, xbid, DKFZp469E066
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193928
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
559425 (Zebrafish (Danio rerio), BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023123
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
559425 (Zebrafish (Danio rerio), BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023124
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471083
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BH3 Interacting Domain Death Agonist (BID)
Gene ID:
637 (Human, BID)
Synonyms:
BID, Bid, bida, bid.S, bid
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083385
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to BID

  • BH3 interacting domain death agonist (BID)
  • BH3 interacting domain death agonist (Bid)
  • BH3 interacting domain death agonist (bida)
  • BH3 interacting domain death agonist S homeolog (bid.S)
  • BH3 interacting domain death agonist (bid)
  • 2700049M22Rik
  • AI875481
  • AU022477
  • BID
  • bid
  • DKFZp469E066
  • FP497
  • fp497
  • si:ch211-238n5.6
  • xbid

Gene-IDs for different species

GENE IDSPECIES
637 Homo sapiens
12122 Mus musculus
64625 Rattus norvegicus
395236 Gallus gallus
458635 Pan troglodytes
510373 Bos taurus
559425 Danio rerio
594852 Sus scrofa
724076 Xenopus laevis
100036674 Xenopus (Silurana) tropicalis
100173269 Pongo abelii
100683675 Canis lupus familiaris
100355991 Oryctolagus cuniculus
100728186 Cavia porcellus

Protein level used designations for BID

  • BH3-interacting domain death agonist
  • BID isoform ES(1b)
  • BID isoform L(2)
  • BID isoform Si6
  • Human BID coding sequence
  • apoptic death agonist
  • desmocollin type 4
  • p22 BID
  • apoptotic death agonist BID
  • BH3 interacting domain death agonist
Other products related to BID such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com