Caspase 3 (Caspase 3, Apoptosis-Related Cysteine Peptidase, CASP3)

Short Description: This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 6, 7 and 9, and the protein itself is processed by caspases 8, 9 and 10. It is the predominant caspase involved in the cleavage of amyloid-beta 4A precursor protein, which is associated with neuronal death in Alzheimer's disease. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008].
More information related to gene Caspase 3.
Products related to Caspase 3 Gene:
130 Products
Data Quality
  • 2
  • 2
Type
  • 123
  • 7
Species
  • 63
  • 31
  • 30
  • 2
  • 2
Application
  • 79
  • 29
  • 27
  • 16
  • 1
Fusion tag
  • 49
  • 19
  • 13
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 52
  • 40
  • 12
  • 9
  • 5
Insert
  • 43
  • 43
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 50
  • 44
  • 24
  • 5
  • 2
Expression Type
  • 103
  • 52
  • 13
Selectable Marker
  • 28
  • 26
  • 13
  • 1
Promoter
  • 37
  • 32
  • 31
  • 14
  • 8
Format
  • 59
  • 27
  • 24
  • 20

Type:
cDNA
Application:
Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
140621 (Zebrafish (Danio rerio), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039735
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
12367 (Mouse (Murine), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463012
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
836 (Human, CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803358
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
25402 (Rat (Rattus), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045832
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
408016 (Cow (Bovine), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057405
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
100151728 (Xenopus tropicalis, CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3984961
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
NCBI Accession:
NM_004346
Species:
Human
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886461
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase
Species:
Human
Synonyms:
CPP32, CPP32B, SCA-1, A830040C14Rik, AC-3, Apopain, CC3, Caspase-3, Lice, Yama, mldy, xcpp32, casp3, zgc:100890, CASP-3, caspase-3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188475
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
140621 (Zebrafish (Danio rerio), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039736
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Species:
Human
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Insert length:
834 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749706
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
12367 (Mouse (Murine), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463010
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
836 (Human, CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803359
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
25402 (Rat (Rattus), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045833
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
408016 (Cow (Bovine), CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057404
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
100151728 (Xenopus tropicalis, CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3984962
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
Gene ID:
836 (Human, CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Insert length:
834 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316009
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
NCBI Accession:
NM_004346
Gene ID:
836 (Human, CASP3)
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Insert length:
834 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4920316
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
NCBI Accession:
NM_004346
Species:
Human
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3968071
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
NCBI Accession:
NM_004346
Species:
Human
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3968069
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 3, Apoptosis-Related Cysteine Peptidase (CASP3)
NCBI Accession:
NM_004346
Species:
Human
Synonyms:
CASP3, Casp3, casp3.S, casp3a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3968077
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Caspase 3

  • caspase 3 (CASP3)
  • caspase 3 (Casp3)
  • caspase 3 S homeolog (casp3.S)
  • caspase 3, apoptosis-related cysteine peptidase a (casp3a)
  • caspase 3, apoptosis-related cysteine peptidase (Casp3)
  • A830040C14Rik
  • AC-3
  • Apopain
  • CASP-3
  • casp3
  • Caspase-3
  • caspase-3
  • CC3
  • CPP32
  • CPP32B
  • Lice
  • mldy
  • SCA-1
  • xcpp32
  • Yama
  • zgc:100890

Gene-IDs for different species

GENE IDSPECIES
836 Homo sapiens
12367 Mus musculus
395476 Gallus gallus
397244 Sus scrofa
397720 Xenopus laevis
403567 Canis lupus familiaris
408016 Bos taurus
493932 Felis catus
100008840 Oryctolagus cuniculus
461669 Pan troglodytes
25402 Rattus norvegicus
100718309 Cavia porcellus
100034083 Equus caballus
443031 Ovis aries
140621 Danio rerio
102144182 Macaca fascicularis
100689061 Cricetulus griseus

Protein level used designations for Caspase 3

  • CASP-3
  • CPP-32
  • PARP cleavage protease
  • SREBP cleavage activity 1
  • apopain
  • caspase 3, apoptosis-related cysteine protease
  • caspase-3
  • cysteine protease CPP32
  • procaspase3
  • protein Yama
  • SCA-1
  • caspase 3, apoptosis related cysteine protease
  • CPP32beta
  • Caspase 3 apoptosis related cysteine protease (ICE-like cysteine protease)
  • Caspase 3, apoptosis related cysteine protease (ICE-like cysteine protease)
  • IRP
  • yama protein
  • Caspase-3-like protein
  • caspase 3, apoptosis-related cysteine peptidase a
  • caspase 3, apoptosis-related cysteine protease a
  • caspase 3, apoptosis-related cysteine peptidase
Other products related to Caspase 3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com