CD22 (CD22 Molecule, CD22)

Short Description: Mediates B-cell B-cell interactions. May be involved in the localization of B-cells in lymphoid tissues. Binds sialylated glycoproteins\; one of which is CD45. Preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site can be masked by cis interactions with sialic acids on the same cell surface. Upon ligand induced tyrosine phosphorylation in the immune response seems to be involved in regulation of B-cell antigen receptor signaling. Plays a role in positive regulation through interaction with Src family tyrosine kinases and may also act as an inhibitory receptor by recruiting cytoplasmic phosphatases via their SH2 domains that block signal transduction through dephosphorylation of signaling molecules.
More information related to gene CD22.
Products related to CD22 Gene:
126 Products
Data Quality
  • 2
Type
  • 120
  • 6
Species
  • 58
  • 40
  • 26
  • 2
Application
  • 69
  • 27
  • 25
  • 16
  • 1
Fusion tag
  • 40
  • 20
  • 16
  • 12
  • 8
Vector Backbone
  • 10
  • 8
  • 8
  • 6
  • 6
Vector
  • 43
  • 40
  • 16
  • 10
  • 9
Insert
  • 43
  • 41
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 51
  • 39
  • 24
  • 6
  • 2
Expression Type
  • 109
  • 60
  • 3
Selectable Marker
  • 39
  • 26
  • 3
  • 2
  • 1
Promoter
  • 49
  • 30
  • 17
  • 11
  • 8
Format
  • 58
  • 36
  • 20
  • 12

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
554810 (Zebrafish (Danio rerio), CD22)
Synonyms:
Cd22, CD22
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4043947
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
12483 (Mouse (Murine), CD22)
Synonyms:
Cd22, CD22
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001873
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
933 (Human, CD22)
Synonyms:
Cd22, CD22
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985205
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
CD22 Molecule
Species:
Human
Synonyms:
A530093D23, Lyb-8, Lyb8, SIGLEC-2, SIGLEC2, siglec-2
PCR Size:
175 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188433
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
554810 (Zebrafish (Danio rerio), CD22)
Synonyms:
Cd22, CD22
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4043948
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Insert length:
2544 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5747069
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
12483 (Mouse (Murine), CD22)
Synonyms:
Cd22, CD22
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001872
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
933 (Human, CD22)
Synonyms:
Cd22, CD22
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985204
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Gene ID:
933 (Human, CD22)
Synonyms:
Cd22, CD22
Insert length:
2028 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325601
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Insert length:
2028 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4419123
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Insert length:
2028 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4484209
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Insert length:
2028 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4627680
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Insert length:
2028 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4775901
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948176

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970599
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970598
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD22 Molecule (CD22)
Species:
Human
Synonyms:
Cd22, CD22
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970600
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD22 Molecule (CD22)
Gene ID:
933 (Human, CD22)
Synonyms:
Cd22, CD22
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414387
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
CD22 Molecule
Species:
Mouse (Murine)
Synonyms:
A530093D23, Lyb-8, Lyb8, SIGLEC-2, SIGLEC2, siglec-2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Cd22 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3347752
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
CD22 Molecule
Species:
Rat (Rattus)
Synonyms:
A530093D23, Lyb-8, Lyb8, SIGLEC-2, SIGLEC2, siglec-2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Cd22 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355983
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
CD22 Molecule
Species:
Human
Synonyms:
A530093D23, Lyb-8, Lyb8, SIGLEC-2, SIGLEC2, siglec-2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • CD22 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3340453
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to CD22

  • CD22 antigen (Cd22)
  • CD22 molecule (CD22)
  • CD22 molecule (Cd22)
  • A530093D23
  • Lyb-8
  • Lyb8
  • SIGLEC-2
  • siglec-2
  • SIGLEC2

Gene-IDs for different species

GENE IDSPECIES
12483 Mus musculus
933 Homo sapiens
514582 Bos taurus
101102835 Ovis aries
308501 Rattus norvegicus
450167 Pan troglodytes
100980861 Pan paniscus

Protein level used designations for CD22

  • B-cell receptor CD22
  • B-lymphocyte cell adhesion molecule
  • BL-CAM
  • T-cell surface antigen Leu-14
  • sialic acid-binding Ig-like lectin 2
  • siglec-2
  • CD22 antigen
  • sialic acid binding Ig-like lectin 2
  • Sialic acid-binding Ig-like lectin 2
Other products related to CD22 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com