CD25 (Interleukin 2 Receptor, alpha, IL2RA)

Short Description: The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009].
More information related to gene CD25.
Products related to CD25 Gene:
143 Products
Type
  • 134
  • 9
Species
  • 45
  • 43
  • 41
  • 12
  • 2
Application
  • 93
  • 27
  • 20
  • 18
  • 3
Fusion tag
  • 47
  • 16
  • 14
  • 11
  • 10
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 68
  • 39
  • 9
  • 8
  • 4
Insert
  • 66
  • 27
  • 21
  • 10
  • 8
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 68
  • 44
  • 18
  • 4
  • 2
Expression Type
  • 82
  • 51
  • 44
Selectable Marker
  • 44
  • 28
  • 25
  • 2
Promoter
  • 51
  • 35
  • 29
  • 10
  • 9
Format
  • 89
  • 26
  • 18
  • 10
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_001308243
Gene ID:
3559 (Human, IL2RA)
Synonyms:
IL2RA, Il2ra, LOC100222957
Insert length:
531 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928469
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
Gene ID:
281861 (Cow (Bovine), IL2RA)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049038
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
Gene ID:
16184 (Mouse (Murine), IL2RA)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988149
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_008367
Species:
Mouse (Murine)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561222
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_013163
Species:
Rat (Rattus)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561223
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_000417
Species:
Human
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887159
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_001032917
Species:
Rhesus Monkey
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104156
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 2 Receptor, alpha
Species:
Rat (Rattus)
Synonyms:
CD25, IDDM10, IL2R, TCGFR, IL2RAC, IL-2RA, Il2r, Ly-43
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196235
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 2 Receptor, alpha
Species:
Mouse (Murine)
Synonyms:
CD25, IDDM10, IL2R, TCGFR, IL2RAC, IL-2RA, Il2r, Ly-43
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193872
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 2 Receptor, alpha
Species:
Human
Synonyms:
CD25, IDDM10, IL2R, TCGFR, IL2RAC, IL-2RA, Il2r, Ly-43
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188569
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
Gene ID:
281861 (Cow (Bovine), IL2RA)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049039
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
Gene ID:
16184 (Mouse (Murine), IL2RA)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988148
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_001308242
Gene ID:
3559 (Human, IL2RA)
Synonyms:
IL2RA, Il2ra, LOC100222957
Insert length:
603 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928468
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_000417
Species:
Human
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911060
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_000417
Species:
Human
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911062
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_013163
Species:
Rat (Rattus)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911085
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_013163
Species:
Rat (Rattus)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911088
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_013163
Species:
Rat (Rattus)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911089
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_013163
Species:
Rat (Rattus)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911090
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 2 Receptor, alpha (IL2RA)
NCBI Accession:
NM_013163
Species:
Rat (Rattus)
Synonyms:
IL2RA, Il2ra, LOC100222957
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911091
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD25

  • interleukin 2 receptor subunit alpha (IL2RA)
  • interleukin 2 receptor subunit alpha (Il2ra)
  • interleukin-2 receptor subunit alpha-like (LOC100222957)
  • interleukin 2 receptor, alpha chain (Il2ra)
  • CD25
  • IDDM10
  • IL-2RA
  • IL2R
  • Il2r
  • IL2RAC
  • Ly-43
  • TCGFR

Gene-IDs for different species

GENE IDSPECIES
3559 Homo sapiens
25704 Rattus norvegicus
395294 Gallus gallus
403870 Canis lupus familiaris
443435 Ovis aries
450884 Pan troglodytes
574300 Macaca mulatta
100222957 Taeniopygia guttata
16184 Mus musculus
396814 Sus scrofa
281861 Bos taurus
100715332 Cavia porcellus
493953 Felis catus
102123605 Macaca fascicularis

Protein level used designations for CD25

  • IL-2 receptor subunit alpha
  • IL-2-RA
  • IL-2R subunit alpha
  • IL2-RA
  • TAC antigen
  • interleukin-2 receptor subunit alpha
  • p55
  • IL-2 receptor alpha subunit
  • interleukin 2 receptor, alpha chain
  • interleukin-2 receptor alpha chain
  • IL-2 alpha receptor
  • IL2 receptor alpha
  • interleukin-2 alpha receptor
  • interleukin 2 receptor alpha chain
  • interleukin-2 receptor alpha subunit
  • IL-2 Receptor alpha chain
  • interleukin 2 receptor, alpha
  • IL-2R alpha chain
  • p55 chain
  • IL-2R alpha
  • cytokine receptor
  • CD25 antigen
Other products related to CD25 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com