CD300E (CD300e Molecule, CD300E)

Short Description: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins expressed on myeloid cells. The protein interacts with the TYRO protein tyrosine kinase-binding protein and is thought to act as an activating receptor. [provided by RefSeq, Nov 2012].
More information related to gene CD300E.
Products related to CD300E Gene:
131 Products
  • 125
  • 6
  • 55
  • 45
  • 31
  • 80
  • 29
  • 19
  • 16
  • 3
Fusion tag
  • 46
  • 15
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 5
  • 61
  • 31
  • 12
  • 9
  • 6
  • 52
  • 41
  • 16
  • 8
  • 6
  • 3
  • 3
Resistance Gene
  • 69
  • 38
  • 12
  • 6
  • 2
Expression Type
  • 80
  • 45
  • 33
Selectable Marker
  • 33
  • 25
  • 22
  • 6
  • 1
  • 44
  • 26
  • 26
  • 13
  • 8
  • 67
  • 27
  • 20
  • 17

Protein Expression, Cloning
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834636
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834635
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995366
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995368
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995367
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
NCBI Accession:
Mouse (Murine)
Cd300e, CD300E
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3558263
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

CD300e Molecule (CD300E)
Cd300e, CD300E
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3558262
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

CD300e Molecule (CD300E)
NCBI Accession:
Rat (Rattus)
Cd300e, CD300E
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3558264
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
CD300e Molecule
BC034097, CLM2, Cd300le, TREM5, CD300LE, CLM-2, CMRF35-A5, IREM-2, IREM2, PIgR-2, PIgR2
-20 °C
Catalog No. ABIN3192527
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
CD300e Molecule
Rat (Rattus)
BC034097, CLM2, Cd300le, TREM5, CD300LE, CLM-2, CMRF35-A5, IREM-2, IREM2, PIgR-2, PIgR2
-20 °C
Catalog No. ABIN3196539
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
CD300e Molecule
Mouse (Murine)
BC034097, CLM2, Cd300le, TREM5, CD300LE, CLM-2, CMRF35-A5, IREM-2, IREM2, PIgR-2, PIgR2
-20 °C
Catalog No. ABIN3194505
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834634
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834639
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995369
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995370
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995371
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Insert length:
618 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5323766
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Protein Expression
CD300e Molecule (CD300E)
NCBI Accession:
Gene ID:
342510 (Human, CD300E)
Cd300e, CD300E
Insert length:
618 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4931744
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
CD300e Molecule (CD300E)
NCBI Accession:
Rat (Rattus)
Cd300e, CD300E
Insert length:
615 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3295456
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
CD300e Molecule (CD300E)
NCBI Accession:
Rat (Rattus)
Cd300e, CD300E
Insert length:
678 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3295459
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to CD300E

  • CD300E molecule (Cd300e)
  • CD300e molecule (CD300E)
  • BC034097
  • Cd300le
  • CD300LE
  • CLM-2
  • CLM2
  • CMRF35-A5
  • IREM-2
  • IREM2
  • PIgR-2
  • PIgR2
  • TREM5

Gene-IDs for different species

217306 Mus musculus
342510 Homo sapiens

Protein level used designations for CD300E

  • CD300 antigen like family member E
  • CD300 antigen-like family member E
  • CLM-2
  • CMRF-35-like molecule-1
  • CMRF35-like molecule 2
  • immune receptor expressed on myeloid cells 2
  • CD300e antigen
  • poly-Ig receptor 2
  • polymeric immunoglobulin receptor 2
Other products related to CD300E such as antibodies, ELISA kits and high-purity proteins are available on our partner website