CD300E (CD300e Molecule, CD300E)

Short Description: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins expressed on myeloid cells. The protein interacts with the TYRO protein tyrosine kinase-binding protein and is thought to act as an activating receptor. [provided by RefSeq, Nov 2012].
More information related to gene CD300E.
Products related to CD300E Gene:
131 Products
Type
  • 125
  • 6
Species
  • 55
  • 45
  • 31
Application
  • 80
  • 29
  • 19
  • 16
  • 3
Fusion tag
  • 46
  • 15
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 5
Vector
  • 61
  • 31
  • 12
  • 9
  • 6
Insert
  • 52
  • 41
  • 16
  • 8
  • 6
Oligo-Type
  • 3
  • 3
Resistance Gene
  • 69
  • 38
  • 12
  • 6
  • 2
Expression Type
  • 80
  • 45
  • 33
Selectable Marker
  • 33
  • 25
  • 22
  • 6
  • 1
Promoter
  • 44
  • 26
  • 26
  • 13
  • 8
Format
  • 67
  • 27
  • 20
  • 17
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995366
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995367
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995368
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3834635
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3834636
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
NCBI Accession:
NM_001166577
Species:
Rat (Rattus)
Synonyms:
Cd300e, CD300E
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558264
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Species:
Human
Synonyms:
Cd300e, CD300E
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558262
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
NCBI Accession:
NM_172050
Species:
Mouse (Murine)
Synonyms:
Cd300e, CD300E
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558263
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
CD300e Molecule
Species:
Mouse (Murine)
Synonyms:
BC034097, CLM2, Cd300le, TREM5, CD300LE, CLM-2, CMRF35-A5, IREM-2, IREM2, PIgR-2, PIgR2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194505
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
CD300e Molecule
Species:
Rat (Rattus)
Synonyms:
BC034097, CLM2, Cd300le, TREM5, CD300LE, CLM-2, CMRF35-A5, IREM-2, IREM2, PIgR-2, PIgR2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196539
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
CD300e Molecule
Species:
Human
Synonyms:
BC034097, CLM2, Cd300le, TREM5, CD300LE, CLM-2, CMRF35-A5, IREM-2, IREM2, PIgR-2, PIgR2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192527
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995370
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995371
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995369
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3834634
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
217306 (Mouse (Murine), CD300E)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3834639
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
CD300e Molecule (CD300E)
Gene ID:
342510 (Human, CD300E)
Synonyms:
Cd300e, CD300E
Insert length:
618 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323766
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
CD300e Molecule (CD300E)
NCBI Accession:
NM_001166577
Species:
Rat (Rattus)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970897
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
CD300e Molecule (CD300E)
NCBI Accession:
NM_001166577
Species:
Rat (Rattus)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970901
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
CD300e Molecule (CD300E)
NCBI Accession:
NM_001166577
Species:
Rat (Rattus)
Synonyms:
Cd300e, CD300E
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970900
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD300E

  • CD300E molecule (Cd300e)
  • CD300e molecule (CD300E)
  • BC034097
  • Cd300le
  • CD300LE
  • CLM-2
  • CLM2
  • CMRF35-A5
  • IREM-2
  • IREM2
  • PIgR-2
  • PIgR2
  • TREM5

Gene-IDs for different species

GENE IDSPECIES
217306 Mus musculus
342510 Homo sapiens

Protein level used designations for CD300E

  • CD300 antigen like family member E
  • CD300 antigen-like family member E
  • CLM-2
  • CMRF-35-like molecule-1
  • CMRF35-like molecule 2
  • immune receptor expressed on myeloid cells 2
  • CD300e antigen
  • poly-Ig receptor 2
  • polymeric immunoglobulin receptor 2
Other products related to CD300E such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com