CD45 (Protein tyrosine Phosphatase, Receptor Type, C, PTPRC)

Short Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012].
More information related to gene CD45.
Products related to CD45 Gene:
208 Products
Type
  • 202
  • 6
Species
  • 84
  • 69
  • 55
Application
  • 136
  • 44
  • 21
  • 16
  • 3
Fusion tag
  • 50
  • 32
  • 20
  • 20
  • 16
Vector Backbone
  • 16
  • 10
  • 10
  • 8
  • 8
Vector
  • 107
  • 41
  • 32
  • 9
  • 8
Insert
  • 88
  • 80
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 3
Resistance Gene
  • 127
  • 40
  • 26
  • 9
  • 2
Expression Type
  • 151
  • 71
  • 46
Selectable Marker
  • 55
  • 46
  • 24
Promoter
  • 67
  • 60
  • 36
  • 30
  • 8
Format
  • 107
  • 72
  • 25
  • 4
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_001267798
Gene ID:
5788 (Human, PTPRC)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Insert length:
264 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4924785
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_002838
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640256
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_001109890
Species:
Rat (Rattus)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640258
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_011210
Species:
Mouse (Murine)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640257
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_080921
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640259
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Protein tyrosine Phosphatase, Receptor Type, C
Species:
Mouse (Murine)
Synonyms:
PTPRC, si:dkeyp-47c5.1, B220, CD45, CD45R, GP180, L-CA, LCA, LY5, T200, Cd45, Ly-5, Lyt-4, loc, Lca, RT7, cd45
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194244
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Protein tyrosine Phosphatase, Receptor Type, C
Species:
Rat (Rattus)
Synonyms:
PTPRC, si:dkeyp-47c5.1, B220, CD45, CD45R, GP180, L-CA, LCA, LY5, T200, Cd45, Ly-5, Lyt-4, loc, Lca, RT7, cd45
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196436
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Protein tyrosine Phosphatase, Receptor Type, C
Species:
Human
Synonyms:
PTPRC, si:dkeyp-47c5.1, B220, CD45, CD45R, GP180, L-CA, LCA, LY5, T200, Cd45, Ly-5, Lyt-4, loc, Lca, RT7, cd45
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189187
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
Gene ID:
19264 (Mouse (Murine), PTPRC)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433865
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_001267798,NP_001254727
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948182

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376527
$310.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_080921
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640236
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_080921
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640238
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_001109890
Species:
Rat (Rattus)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640239
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_001109890
Species:
Rat (Rattus)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640240
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_080921
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640242
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_011210
Species:
Mouse (Murine)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640244
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_011210
Species:
Mouse (Murine)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640246
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_011210
Species:
Mouse (Murine)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640248
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_080921
Species:
Human
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640249
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Protein tyrosine Phosphatase, Receptor Type, C (PTPRC)
NCBI Accession:
NM_011210
Species:
Mouse (Murine)
Synonyms:
PTPRC, ptprc, LOC100074271, Ptprc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3640251
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to CD45

  • protein tyrosine phosphatase, receptor type C (PTPRC)
  • protein tyrosine phosphatase, receptor type, C (ptprc)
  • receptor-type tyrosine-protein phosphatase C (LOC100074271)
  • protein tyrosine phosphatase, receptor type, C (Ptprc)
  • B220
  • cd45
  • CD45
  • Cd45
  • CD45R
  • GP180
  • L-CA
  • LCA
  • Lca
  • loc
  • Ly-5
  • LY5
  • Lyt-4
  • PTPRC
  • RT7
  • si:dkeyp-47c5.1
  • T200

Gene-IDs for different species

GENE IDSPECIES
386580 Gallus gallus
457607 Pan troglodytes
490255 Canis lupus familiaris
559154 Danio rerio
100026890 Monodelphis domestica
100061950 Equus caballus
100074271 Ornithorhynchus anatinus
100358807 Oryctolagus cuniculus
100446144 Pongo abelii
100474611 Ailuropoda melanoleuca
100522631 Sus scrofa
100546661 Meleagris gallopavo
5788 Homo sapiens
19264 Mus musculus
24699 Rattus norvegicus
407152 Bos taurus

Protein level used designations for CD45

  • receptor-type tyrosine-protein phosphatase C
  • leukocyte common antigen, CD45
  • protein tyrosine phosphatase, receptor type, C
  • CD45 antigen
  • leukocyte common antigen
  • receptor-type tyrosine-protein phosphatase C-like
  • T200 glycoprotein
  • T200 leukocyte common antigen
  • protein tyrosine phosphatase, receptor type, c polypeptide
  • lymphocyte antigen 5
  • lymphocyte common antigen
  • Protein tyrosine phosphatase, receptor-type, c polypeptide
  • leucocyte common antigen
  • leukocyte common antigen A
  • leukocyte common antigen B
  • membrane tyrosine phosphatase
Other products related to CD45 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com