CXorf66 (Chromosome X Open Reading Frame 66, CXorf66)

Short Description: The protein encoded by this gene is predicted to be a type I membrane protein, however, its exact function is not known. [provided by RefSeq, Sep 2009].
More information related to gene CXorf66.
Products related to CXorf66 Gene:
29 Products
  • 27
  • 2
  • 29
  • 13
  • 9
  • 7
  • 4
Fusion tag
  • 13
  • 6
  • 4
  • 4
  • 1
Vector Backbone
  • 4
  • 2
  • 2
  • 2
  • 2
  • 13
  • 6
  • 4
  • 3
  • 1
  • 8
  • 7
  • 5
  • 3
  • 2
  • 2
Resistance Gene
  • 16
  • 6
  • 4
  • 2
  • 1
Expression Type
  • 22
  • 15
Selectable Marker
  • 10
  • 10
  • 12
  • 8
  • 4
  • 2
  • 2
  • 14
  • 8
  • 7

Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4017395
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4017396
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4017394
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4017393
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3415561
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
NCBI Accession:
Insert length:
1086 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5417984
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CXorf66
Viral Particles
-80 °C
Catalog No. ABIN5128138
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
Chromosome X Open Reading Frame 66
HPLC purified
Available with shipment
  • CXorf66 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3314663
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5417983
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Genome Editing with Engineered Nucleases
Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5035874
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Chromosome X Open Reading Frame 66
Gene ID:
347487 (Human, CXorf66)
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5793396
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
NCBI Accession:
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CXorf66
Viral Particles
-80 °C
Catalog No. ABIN5243567
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN4189933
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Chromosome X Open Reading Frame 66 (CXorf66)
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3740055
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Chromosome X Open Reading Frame 66 (CXorf66)
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
RFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3719716
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Chromosome X Open Reading Frame 66 (CXorf66)
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3657153
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Chromosome X Open Reading Frame 66 (CXorf66)
Gene ID:
347487 (Human, CXorf66)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter, U6 Promoter
Fusion Tag:
GFP tag
Stable, Transient

This product contains 3 separate slightly different shRNA sequences which knock down human CXorf66 gene specifically. Each vial contains 50 μg of lyophilized shRNA.
4 °C,-20 °C,-80 °C
Catalog No. ABIN5825190
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
NCBI Accession:
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3299976
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
Chromosome X Open Reading Frame 66 (CXorf66)
NCBI Accession:
Insert length:
1086 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5417986
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

RNA Interference
Chromosome X Open Reading Frame 66 (CXorf66)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable

Empty vector controls:

  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
4 °C/-20 °C
Catalog No. ABIN3760393
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to CXorf66

  • chromosome X open reading frame 66 (CXorf66)

Gene-IDs for different species

347487 Homo sapiens

Protein level used designations for CXorf66

  • RP11-35F15.2
  • uncharacterized protein CXorf66
Other products related to CXorf66 such as antibodies, ELISA kits and high-purity proteins are available on our partner website