EGFR (Epidermal Growth Factor Receptor, EGFR)

Short Description: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010].
More information related to gene EGFR.
Products related to EGFR Gene:
162 Products
Data Quality
  • 4
Type
  • 155
  • 7
Species
  • 62
  • 52
  • 35
  • 13
Application
  • 110
  • 24
  • 24
  • 16
  • 3
Fusion tag
  • 37
  • 21
  • 21
  • 17
  • 11
Vector Backbone
  • 10
  • 9
  • 6
  • 6
  • 6
Vector
  • 83
  • 42
  • 16
  • 9
  • 3
Insert
  • 76
  • 43
  • 20
  • 8
  • 6
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 82
  • 48
  • 25
  • 2
Expression Type
  • 106
  • 59
  • 44
Selectable Marker
  • 44
  • 33
  • 27
Promoter
  • 52
  • 50
  • 30
  • 18
  • 8
Format
  • 97
  • 32
  • 24
  • 9

Type:
ORF
Application:
Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_201282,NP_958439
Species:
Human
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Insert length:
1887 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5346356
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_201282
Gene ID:
1956 (Human, EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Insert length:
1887 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939849
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
Gene ID:
1956 (Human, EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCP
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098184
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
Gene ID:
13649 (Mouse (Murine), EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808431
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
Gene ID:
1956 (Human, EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210923
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_207655
Species:
Mouse (Murine)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104272
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
Species:
Rat (Rattus)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104273
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
XM_533073
Species:
Dog (Canine)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104050
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Epidermal Growth Factor Receptor
Species:
Mouse (Murine)
Synonyms:
C-erb, CG10079, D-EGFR, D-Egf, DEGFR, DER, DER flb, DER/EGFR, DER/faint little ball, DER/top, DER/torpedo, DER1, DEgfr, Degfr, Der, DmHD-33, Dmel\\CG10079, EFG-R, EGF-R, EGFR, EGFr, EGfr, EK2-6, Egf, Egf-r, EgfR, El, Elp, Elp-1, Elp-B1, Elp-B1RB1, HD-33, TOP, Torpedo/DER, Torpedo/Egfr, c-erbB, d-egf-r, dEGFR, dEGFR1, dEgfr, der, egfr, flb, l(2)05351, l(2)09261, l(2)57DEFa, l(2)57EFa, l(2)57Ea, mor1, top, top/DER, top/flb, torpedo/Egfr, torpedo/egfr, EGFR12, EGFR15, egfr1, Erbb2, ERBB, ERBB1, HER1, PIG61, mENA, ErbB-1, Errp, 9030024J15Rik, AI552599, Erbb, Errb1, Wa5, wa-2, wa2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194585
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Epidermal Growth Factor Receptor
Species:
Rat (Rattus)
Synonyms:
C-erb, CG10079, D-EGFR, D-Egf, DEGFR, DER, DER flb, DER/EGFR, DER/faint little ball, DER/top, DER/torpedo, DER1, DEgfr, Degfr, Der, DmHD-33, Dmel\\CG10079, EFG-R, EGF-R, EGFR, EGFr, EGfr, EK2-6, Egf, Egf-r, EgfR, El, Elp, Elp-1, Elp-B1, Elp-B1RB1, HD-33, TOP, Torpedo/DER, Torpedo/Egfr, c-erbB, d-egf-r, dEGFR, dEGFR1, dEgfr, der, egfr, flb, l(2)05351, l(2)09261, l(2)57DEFa, l(2)57EFa, l(2)57Ea, mor1, top, top/DER, top/flb, torpedo/Egfr, torpedo/egfr, EGFR12, EGFR15, egfr1, Erbb2, ERBB, ERBB1, HER1, PIG61, mENA, ErbB-1, Errp, 9030024J15Rik, AI552599, Erbb, Errb1, Wa5, wa-2, wa2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196261
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Epidermal Growth Factor Receptor
NCBI Accession:
NM_005228, NM_201282, NM_201284
Species:
Human
Synonyms:
C-erb, CG10079, D-EGFR, D-Egf, DEGFR, DER, DER flb, DER/EGFR, DER/faint little ball, DER/top, DER/torpedo, DER1, DEgfr, Degfr, Der, DmHD-33, Dmel\\CG10079, EFG-R, EGF-R, EGFR, EGFr, EGfr, EK2-6, Egf, Egf-r, EgfR, El, Elp, Elp-1, Elp-B1, Elp-B1RB1, HD-33, TOP, Torpedo/DER, Torpedo/Egfr, c-erbB, d-egf-r, dEGFR, dEGFR1, dEgfr, der, egfr, flb, l(2)05351, l(2)09261, l(2)57DEFa, l(2)57EFa, l(2)57Ea, mor1, top, top/DER, top/flb, torpedo/Egfr, torpedo/egfr, EGFR12, EGFR15, egfr1, Erbb2, ERBB, ERBB1, HER1, PIG61, mENA, ErbB-1, Errp, 9030024J15Rik, AI552599, Erbb, Errb1, Wa5, wa-2, wa2
PCR Size:
123 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188429
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
Gene ID:
13649 (Mouse (Murine), EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808432
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epidermal Growth Factor Receptor (EGFR)
Gene ID:
1956 (Human, EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210924
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_201283
Gene ID:
1956 (Human, EGFR)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Insert length:
1218 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939848
$339.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_005228
Species:
Human
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of EGFR
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5087878
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_207655
Species:
Mouse (Murine)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Egfr
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5087880
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_031507
Species:
Rat (Rattus)
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Egfr
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5087882
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Epidermal Growth Factor Receptor (EGFR)
NCBI Accession:
NM_201283,NP_958440
Species:
Human
Synonyms:
EGFR, Egfr, egfra, egfr1, LOC5564544
Insert length:
1218 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5346355
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Epidermal Growth Factor Receptor
Species:
Rat (Rattus)
Synonyms:
C-erb, CG10079, D-EGFR, D-Egf, DEGFR, DER, DER flb, DER/EGFR, DER/faint little ball, DER/top, DER/torpedo, DER1, DEgfr, Degfr, Der, DmHD-33, Dmel\\CG10079, EFG-R, EGF-R, EGFR, EGFr, EGfr, EK2-6, Egf, Egf-r, EgfR, El, Elp, Elp-1, Elp-B1, Elp-B1RB1, HD-33, TOP, Torpedo/DER, Torpedo/Egfr, c-erbB, d-egf-r, dEGFR, dEGFR1, dEgfr, der, egfr, flb, l(2)05351, l(2)09261, l(2)57DEFa, l(2)57EFa, l(2)57Ea, mor1, top, top/DER, top/flb, torpedo/Egfr, torpedo/egfr, EGFR12, EGFR15, egfr1, Erbb2, ERBB, ERBB1, HER1, PIG61, mENA, ErbB-1, Errp, 9030024J15Rik, AI552599, Erbb, Errb1, Wa5, wa-2, wa2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Egfr (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355647
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Epidermal Growth Factor Receptor
Species:
Mouse (Murine)
Synonyms:
C-erb, CG10079, D-EGFR, D-Egf, DEGFR, DER, DER flb, DER/EGFR, DER/faint little ball, DER/top, DER/torpedo, DER1, DEgfr, Degfr, Der, DmHD-33, Dmel\\CG10079, EFG-R, EGF-R, EGFR, EGFr, EGfr, EK2-6, Egf, Egf-r, EgfR, El, Elp, Elp-1, Elp-B1, Elp-B1RB1, HD-33, TOP, Torpedo/DER, Torpedo/Egfr, c-erbB, d-egf-r, dEGFR, dEGFR1, dEgfr, der, egfr, flb, l(2)05351, l(2)09261, l(2)57DEFa, l(2)57EFa, l(2)57Ea, mor1, top, top/DER, top/flb, torpedo/Egfr, torpedo/egfr, EGFR12, EGFR15, egfr1, Erbb2, ERBB, ERBB1, HER1, PIG61, mENA, ErbB-1, Errp, 9030024J15Rik, AI552599, Erbb, Errb1, Wa5, wa-2, wa2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Egfr (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3266270
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to EGFR

  • epidermal growth factor receptor (EGFR)
  • Epidermal growth factor receptor (Egfr)
  • epidermal growth factor receptor a (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) (egfra)
  • epidermal growth factor receptor (egfr1)
  • epidermal growth factor receptor (LOC5564544)
  • epidermal growth factor receptor (Egfr)
  • 9030024J15Rik
  • AI552599
  • C-erb
  • c-erbB
  • CG10079
  • D-Egf
  • d-egf-r
  • D-EGFR
  • dEgfr
  • DEGFR
  • DEgfr
  • Degfr
  • dEGFR
  • dEGFR1
  • DER
  • der
  • Der
  • DER/EGFR
  • DER/faint little ball
  • DER/top
  • DER/torpedo
  • DER1
  • DER flb
  • Dmel\\CG10079
  • DmHD-33
  • EFG-R
  • Egf
  • EGF-R
  • Egf-r
  • egfr
  • EgfR
  • EGFr
  • EGFR
  • EGfr
  • egfr1
  • EGFR12
  • EGFR15
  • EK2-6
  • El
  • Elp
  • Elp-1
  • Elp-B1
  • Elp-B1RB1
  • Erbb
  • ERBB
  • ErbB-1
  • ERBB1
  • Erbb2
  • Errb1
  • Errp
  • flb
  • HD-33
  • HER1
  • l(2)05351
  • l(2)09261
  • l(2)57DEFa
  • l(2)57Ea
  • l(2)57EFa
  • mENA
  • mor1
  • PIG61
  • top
  • TOP
  • top/DER
  • top/flb
  • Torpedo/DER
  • torpedo/egfr
  • torpedo/Egfr
  • Torpedo/Egfr
  • wa-2
  • wa2
  • Wa5

Gene-IDs for different species

GENE IDSPECIES
100067755 Equus caballus
37455 Drosophila melanogaster
378478 Danio rerio
778955 Ciona intestinalis
5564544 Aedes aegypti
1956 Homo sapiens
24329 Rattus norvegicus
13649 Mus musculus
396494 Gallus gallus
397070 Sus scrofa
404306 Canis lupus familiaris
407217 Bos taurus
100008806 Oryctolagus cuniculus
100725363 Cavia porcellus
780479 Ovis aries
613027 Macaca mulatta

Protein level used designations for EGFR

  • CG10079-PA
  • CG10079-PB
  • DER-Ellipse
  • EGF-receptor
  • EGFR
  • Egf receptor
  • Egfr-PA
  • Egfr-PB
  • drosophila epidermal growth factor receptor homologue
  • ellipse
  • ellipse torpedo
  • epidermal growth factor receptor
  • faint little ball
  • morphological defects 1
  • torpedo
  • torpedo/DER
  • erbb1a
  • avian erythroblastic leukemia viral (v-erb-b) oncogene homolog
  • cell growth inhibiting protein 40
  • cell proliferation-inducing protein 61
  • proto-oncogene c-ErbB-1
  • receptor tyrosine-protein kinase erbB-1
  • EGFR-related peptide
  • Epidermal growth factor receptor formerly avian erythroblastic leukemia viral (v-erbB) oncogene homolog (Erbb1)
  • avian erythroblastic leukemia viral (v-erbB) oncogene homolog
  • epidermal growth factor receptor, formerly avian erythroblastic leukemia viral (v-erbB) oncogene homolog (Erbb1)
  • waved 2
  • CER
  • epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)
  • egf receptor
  • receptor tyrosine kinase ErbB1
Other products related to EGFR such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com