Epiregulin (Epiregulin, EREG)

Short Description: Epiregulin is a member of the epidermal growth factor family. Epiregulin can function as a ligand of EGFR (epidermal growth factor receptor), as well as a ligand of most members of the ERBB (v-erb-b2 oncogene homolog) family of tyrosine-kinase receptors. [provided by RefSeq, Jul 2008].
More information related to gene Epiregulin.
Products related to Epiregulin Gene:
116 Products
Type
  • 110
  • 6
Species
  • 49
  • 42
  • 25
Application
  • 68
  • 24
  • 20
  • 16
  • 2
Fusion tag
  • 35
  • 15
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 47
  • 35
  • 12
  • 9
  • 4
Insert
  • 39
  • 35
  • 20
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 53
  • 38
  • 18
  • 2
  • 1
Expression Type
  • 81
  • 48
  • 22
Selectable Marker
  • 28
  • 26
  • 22
Promoter
  • 30
  • 30
  • 29
  • 13
  • 8
Format
  • 59
  • 24
  • 22
  • 11

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Epiregulin (EREG)
Gene ID:
13874 (Mouse (Murine), EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214566
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
Gene ID:
2069 (Human, EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998947
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
Gene ID:
2069 (Human, EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998948
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_001432
Species:
Human
Synonyms:
EREG, ereg, Ereg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559751
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_007950
Species:
Mouse (Murine)
Synonyms:
EREG, ereg, Ereg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559752
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Epiregulin
Species:
Human
Synonyms:
EREG, ER, EPR, proepiregulin
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188977
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Epiregulin
Species:
Mouse (Murine)
Synonyms:
EREG, ER, EPR, proepiregulin
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194139
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Epiregulin (EREG)
Gene ID:
13874 (Mouse (Murine), EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214567
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
Gene ID:
2069 (Human, EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998946
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
Gene ID:
2069 (Human, EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998945
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
Species:
Human
Synonyms:
EREG, ereg, Ereg
Insert length:
510 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4701804
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Epiregulin (EREG)
Species:
Human
Synonyms:
EREG, ereg, Ereg
Insert length:
510 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4830933
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Epiregulin (EREG)
Gene ID:
2069 (Human, EREG)
Synonyms:
EREG, ereg, Ereg
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415448
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_021689,NP_067721
Species:
Rat (Rattus)
Synonyms:
EREG, ereg, Ereg
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3291890
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_007950,NP_031976
Species:
Mouse (Murine)
Synonyms:
EREG, ereg, Ereg
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3291889
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_001432,NP_001423
Species:
Human
Synonyms:
EREG, ereg, Ereg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3389484
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_021689
Species:
Rat (Rattus)
Synonyms:
EREG, ereg, Ereg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ereg
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082110
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_007950
Species:
Mouse (Murine)
Synonyms:
EREG, ereg, Ereg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ereg
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082108
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_001432
Species:
Human
Synonyms:
EREG, ereg, Ereg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of EREG
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082106
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Epiregulin (EREG)
NCBI Accession:
NM_001432,NP_001423
Species:
Human
Synonyms:
EREG, ereg, Ereg
Insert length:
510 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5498682
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to Epiregulin

  • epiregulin (EREG)
  • epiregulin (ereg)
  • epiregulin (Ereg)
  • EPR
  • ER
  • EREG
  • proepiregulin

Gene-IDs for different species

GENE IDSPECIES
740028 Pan troglodytes
611946 Canis lupus familiaris
702502 Macaca mulatta
733987 Xenopus (Silurana) tropicalis
100219479 Taeniopygia guttata
2069 Homo sapiens
13874 Mus musculus
59325 Rattus norvegicus
408036 Gallus gallus
100343410 Oryctolagus cuniculus
100715763 Cavia porcellus

Protein level used designations for Epiregulin

  • epiregulin
  • Proepiregulin
  • proepiregulin
Other products related to Epiregulin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com