GPR50 (G Protein-Coupled Receptor 50, GPR50)

Short Description: This gene product belongs to the G-protein coupled receptor 1 family. Even though this protein shares similarity with the melatonin receptors, it does not bind melatonin, however, it inhibits melatonin receptor 1A function through heterodimerization. Polymorphic variants of this gene have been associated with bipolar affective disorder in women. [provided by RefSeq, Jan 2010].
More information related to gene GPR50.
Products related to GPR50 Gene:
  • 81
  • 1
  • 37
  • 28
  • 17
  • 39
  • 24
  • 16
  • 15
Fusion tag
  • 30
  • 9
  • 9
  • 8
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
  • 30
  • 21
  • 12
  • 11
  • 6
  • 35
  • 16
  • 14
  • 8
  • 6
  • 1
Resistance Gene
  • 36
  • 29
  • 12
  • 4
  • 2
Expression Type
  • 72
  • 42
Selectable Marker
  • 24
  • 22
  • 6
  • 24
  • 24
  • 13
  • 8
  • 6
  • 27
  • 23
  • 20
  • 12
82 Products

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987115
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987119
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987118
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
14765 (Mouse, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4002489
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987114
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987116
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987117
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
14765 (Mouse, GPR50)
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4002490
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5324573
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5434610
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
GPR50, Gpr50
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GPR50
Viral Particles
-80 °C
Catalog No. ABIN5138174
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
GPR50, Gpr50
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gpr50
Viral Particles
-80 °C
Catalog No. ABIN5138178
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
GPR50, Gpr50
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gpr50
Viral Particles
-80 °C
Catalog No. ABIN5138176
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
G Protein-Coupled Receptor 50
H9, Mel1c
HPLC purified
Available with shipment
  • Gpr50 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3265426
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

G Protein-Coupled Receptor 50 (GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5750611
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

G Protein-Coupled Receptor 50 (GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4703294
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

G Protein-Coupled Receptor 50 (GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4832424
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

G Protein-Coupled Receptor 50 (GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4776459
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

G Protein-Coupled Receptor 50 (GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4628238
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
G Protein-Coupled Receptor 50 (GPR50)
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4484767
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GPR50

  • G protein-coupled receptor 50 (GPR50)
  • G protein-coupled receptor 50 (Gpr50)
  • G-protein-coupled receptor 50 (Gpr50)
  • H9
  • Mel1c

Gene-IDs for different species

492213 Canis lupus familiaris
530065 Bos taurus
736267 Pan troglodytes
9248 Homo sapiens
117097 Rattus norvegicus
443023 Ovis aries
14765 Mus musculus

Protein level used designations for GPR50

  • G protein-coupled receptor 50
  • melatonin-related receptor
  • g protein-coupled receptor 50
Other products related to GPR50 such as antibodies, ELISA kits and high-purity proteins are available on our partner website