GPR50 (G Protein-Coupled Receptor 50, GPR50)

Short Description: This gene product belongs to the G-protein coupled receptor 1 family. Even though this protein shares similarity with the melatonin receptors, it does not bind melatonin, however, it inhibits melatonin receptor 1A function through heterodimerization. Polymorphic variants of this gene have been associated with bipolar affective disorder in women. [provided by RefSeq, Jan 2010].
More information related to gene GPR50.
Products related to GPR50 Gene:
86 Products
Type
  • 83
  • 3
Species
  • 39
  • 30
  • 17
Application
  • 39
  • 24
  • 19
  • 16
Fusion tag
  • 32
  • 11
  • 9
  • 8
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 30
  • 23
  • 12
  • 11
  • 6
Insert
  • 35
  • 16
  • 16
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 38
  • 29
  • 12
  • 4
  • 2
Expression Type
  • 74
  • 44
Selectable Marker
  • 26
  • 22
  • 6
Promoter
  • 26
  • 26
  • 13
  • 8
  • 6
Format
  • 27
  • 27
  • 20
  • 12

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987115
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987119
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987118
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
14765 (Mouse (Murine), GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002489
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987114
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987117
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987116
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
14765 (Mouse (Murine), GPR50)
Synonyms:
GPR50, Gpr50
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002490
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Gene ID:
9248 (Human, GPR50)
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324573
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
NM_004224,NP_004215
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5434610
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
NM_004224
Species:
Human
Synonyms:
GPR50, Gpr50
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GPR50
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5138174
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
NM_001191915
Species:
Rat (Rattus)
Synonyms:
GPR50, Gpr50
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gpr50
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5138178
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
G Protein-Coupled Receptor 50 (GPR50)
NCBI Accession:
NM_010340
Species:
Mouse (Murine)
Synonyms:
GPR50, Gpr50
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gpr50
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5138176
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
G Protein-Coupled Receptor 50
Species:
Mouse (Murine)
Synonyms:
H9, Mel1c
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Gpr50 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3265426
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5750611
$441.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4419681
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4484767
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4703294
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4628238
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 50 (GPR50)
Species:
Human
Synonyms:
GPR50, Gpr50
Insert length:
1854 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832424
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GPR50

  • G protein-coupled receptor 50 (GPR50)
  • G protein-coupled receptor 50 (Gpr50)
  • G-protein-coupled receptor 50 (Gpr50)
  • H9
  • Mel1c

Gene-IDs for different species

GENE IDSPECIES
492213 Canis lupus familiaris
530065 Bos taurus
736267 Pan troglodytes
9248 Homo sapiens
117097 Rattus norvegicus
443023 Ovis aries
14765 Mus musculus

Protein level used designations for GPR50

  • G protein-coupled receptor 50
  • melatonin-related receptor
  • g protein-coupled receptor 50
Other products related to GPR50 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com