HGF (Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor), HGF)

Short Description: Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor. Hepatocyte growth factor is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. It is secreted as a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. The protein belongs to the plasminogen subfamily of S1 peptidases but has no detectable protease activity. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
More information related to gene HGF.
Products related to HGF Gene:
205 Products
Data Quality
  • 1
  • 5
Type
  • 196
  • 9
Species
  • 95
  • 46
  • 40
  • 12
  • 12
Application
  • 137
  • 34
  • 27
  • 20
  • 3
Fusion tag
  • 60
  • 25
  • 21
  • 15
  • 15
Vector Backbone
  • 12
  • 8
  • 8
  • 7
  • 7
Vector
  • 109
  • 42
  • 20
  • 9
  • 6
Insert
  • 93
  • 62
  • 21
  • 10
  • 8
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 110
  • 61
  • 20
  • 5
  • 2
Expression Type
  • 123
  • 70
  • 57
Selectable Marker
  • 57
  • 53
  • 28
  • 1
Promoter
  • 71
  • 53
  • 35
  • 25
  • 10
Format
  • 130
  • 40
  • 22
  • 13

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
15234 (Mouse (Murine), HGF)
Synonyms:
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002608
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999325
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999324
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_010427
Species:
Mouse (Murine)
Synonyms:
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103868
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
XM_001108226
Species:
Rhesus Monkey
Synonyms:
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104118
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_017017
Species:
Rat (Rattus)
Synonyms:
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104295
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_001002964
Species:
Dog (Canine)
Synonyms:
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104119
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_000601
Species:
Human
Synonyms:
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887041
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor)
Species:
Human
Synonyms:
DFNB39, F-TCF, HGFB, HPTA, SF, HGF, C230052L06Rik, HGF/SF, NK1, NK2, SF/HGF
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188826
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor)
Species:
Mouse (Murine)
Synonyms:
DFNB39, F-TCF, HGFB, HPTA, SF, HGF, C230052L06Rik, HGF/SF, NK1, NK2, SF/HGF
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193594
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor)
Species:
Rat (Rattus)
Synonyms:
DFNB39, F-TCF, HGFB, HPTA, SF, HGF, C230052L06Rik, HGF/SF, NK1, NK2, SF/HGF
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196566
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
15234 (Mouse (Murine), HGF)
Synonyms:
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002609
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999322
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999323
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Insert length:
633 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320585
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Insert length:
858 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321261
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_001010931
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Insert length:
873 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928831
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Insert length:
2187 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324167
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_001289460,NP_001276389
Species:
Mouse (Murine)
Synonyms:
HGF, Hgf
Insert length:
636 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3325058
$210.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
NM_001010934
Gene ID:
3082 (Human, HGF)
Synonyms:
HGF, Hgf
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4928832
$269.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to HGF

  • hepatocyte growth factor (HGF)
  • hepatocyte growth factor (Hgf)
  • C230052L06Rik
  • DFNB39
  • F-TCF
  • HGF
  • HGF/SF
  • HGFB
  • HPTA
  • NK1
  • NK2
  • SF
  • SF/HGF

Gene-IDs for different species

GENE IDSPECIES
3082 Homo sapiens
708316 Macaca mulatta
15234 Mus musculus
24446 Rattus norvegicus
282879 Bos taurus
395941 Gallus gallus
403441 Canis lupus familiaris
443075 Ovis aries
493705 Felis catus
100316908 Oryctolagus cuniculus
100525120 Sus scrofa
100730730 Cavia porcellus

Protein level used designations for HGF

  • fibroblast-derived tumor cytotoxic factor
  • hepatocyte growth factor
  • hepatopoeitin-A
  • hepatopoietin-A
  • lung fibroblast-derived mitogen
  • SF
  • scatter factor
  • hepapoietin A
  • HGF alpha-chain
  • hepatocyte growth factor /scatter factor
Other products related to HGF such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com