HGF (Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor), HGF)

Short Description: Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor. Hepatocyte growth factor is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. It is secreted as a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. The protein belongs to the plasminogen subfamily of S1 peptidases but has no detectable protease activity. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
More information related to gene HGF.
Products related to HGF Gene:
205 Products
Data Quality
  • 1
  • 196
  • 9
  • 95
  • 46
  • 40
  • 12
  • 12
  • 137
  • 34
  • 27
  • 20
  • 3
Fusion tag
  • 60
  • 25
  • 21
  • 15
  • 15
Vector Backbone
  • 12
  • 8
  • 8
  • 7
  • 7
  • 109
  • 42
  • 20
  • 9
  • 6
  • 93
  • 62
  • 21
  • 10
  • 8
  • 6
  • 3
Resistance Gene
  • 110
  • 61
  • 20
  • 5
  • 2
Expression Type
  • 123
  • 70
  • 57
Selectable Marker
  • 57
  • 53
  • 28
  • 1
  • 71
  • 53
  • 35
  • 25
  • 10
  • 130
  • 40
  • 22
  • 13

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
15234 (Mouse (Murine), HGF)
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4002608
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999324
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999325
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN3887041
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Mouse (Murine)
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN4103868
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Rhesus Monkey
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN4104118
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Dog (Canine)
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN4104119
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Rat (Rattus)
HGF, Hgf
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN4104295
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor)
Rat (Rattus)
-20 °C
Catalog No. ABIN3196566
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor)
-20 °C
Catalog No. ABIN3188826
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor)
Mouse (Murine)
-20 °C
Catalog No. ABIN3193594
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
15234 (Mouse (Murine), HGF)
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4002609
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999322
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999323
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Insert length:
633 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5320585
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Insert length:
858 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5321261
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Protein Expression
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Insert length:
873 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4928831
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Insert length:
2187 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5324167
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Mouse (Murine)
HGF, Hgf
Insert length:
636 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3325058
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
ISO 9001:2008

Protein Expression
Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF)
NCBI Accession:
Gene ID:
3082 (Human, HGF)
HGF, Hgf
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4928832
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to HGF

  • hepatocyte growth factor (HGF)
  • hepatocyte growth factor (Hgf)
  • C230052L06Rik
  • DFNB39
  • F-TCF
  • HGF
  • HGF/SF
  • HGFB
  • HPTA
  • NK1
  • NK2
  • SF
  • SF/HGF

Gene-IDs for different species

3082 Homo sapiens
708316 Macaca mulatta
15234 Mus musculus
24446 Rattus norvegicus
282879 Bos taurus
395941 Gallus gallus
403441 Canis lupus familiaris
443075 Ovis aries
493705 Felis catus
100316908 Oryctolagus cuniculus
100525120 Sus scrofa
100730730 Cavia porcellus

Protein level used designations for HGF

  • fibroblast-derived tumor cytotoxic factor
  • hepatocyte growth factor
  • hepatopoeitin-A
  • hepatopoietin-A
  • lung fibroblast-derived mitogen
  • SF
  • scatter factor
  • hepapoietin A
  • HGF alpha-chain
  • hepatocyte growth factor /scatter factor
Other products related to HGF such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com