IRAK3 (Interleukin-1 Receptor-Associated Kinase 3, IRAK3)

Short Description: This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010].
More information related to gene IRAK3.
Products related to IRAK3 Gene:
119 Products
Data Quality
  • 1
Type
  • 115
  • 4
Species
  • 47
  • 44
  • 28
Application
  • 66
  • 27
  • 24
  • 16
Fusion tag
  • 41
  • 18
  • 13
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 41
  • 39
  • 12
  • 12
  • 9
Insert
  • 40
  • 39
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 44
  • 44
  • 22
  • 5
  • 2
Expression Type
  • 93
  • 50
  • 11
Selectable Marker
  • 30
  • 26
  • 11
Promoter
  • 37
  • 30
  • 20
  • 15
  • 8
Format
  • 53
  • 27
  • 24
  • 15

Type:
ORF
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5741218
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
11213 (Human, IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212126
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
11213 (Human, IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095649
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
314870 (Rat (Rattus), IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3880760
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
73914 (Mouse (Murine), IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4008665
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
73914 (Mouse (Murine), IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4008666
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
NCBI Accession:
NM_028679
Species:
Mouse (Murine)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561304
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
11213 (Human, IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212125
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
11213 (Human, IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095650
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
73914 (Mouse (Murine), IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4008667
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
73914 (Mouse (Murine), IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4008668
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
314870 (Rat (Rattus), IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3880758
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Gene ID:
11213 (Human, IRAK3)
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319699
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4438129
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372400
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4477034
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4704512
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4768702
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
Species:
Human
Synonyms:
IRAK3, irak3, Irak3
Insert length:
1791 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4833642
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin-1 Receptor-Associated Kinase 3 (IRAK3)
NCBI Accession:
NM_028679
Species:
Mouse (Murine)
Synonyms:
IRAK3, irak3, Irak3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3947555
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to IRAK3

  • interleukin 1 receptor associated kinase 3 (IRAK3)
  • interleukin-1 receptor-associated kinase 3 (irak3)
  • interleukin-1 receptor-associated kinase 3 (Irak3)
  • 4833428C18Rik
  • AI563835
  • ASRT5
  • IRAK-M
  • IRAK3
  • IRAKM
  • IrakM
  • si:dkey-150i15.2

Gene-IDs for different species

GENE IDSPECIES
100441850 Pongo abelii
100483119 Ailuropoda melanoleuca
467058 Pan troglodytes
481150 Canis lupus familiaris
567444 Danio rerio
717845 Macaca mulatta
100024979 Monodelphis domestica
100583020 Nomascus leucogenys
11213 Homo sapiens
510342 Bos taurus
73914 Mus musculus
314870 Rattus norvegicus
100514645 Sus scrofa

Protein level used designations for IRAK3

  • interleukin-1 receptor-associated kinase 3
  • interleukin-1 receptor-associated kinase 3-like
  • IL-1 receptor-associated kinase M
  • interleukin-1 receptor-associated kinase M
  • IRAK-3
Other products related to IRAK3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com