JAK2 (Janus Kinase 2, JAK2)

Short Description: This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008].
More information related to gene JAK2.
Products related to JAK2 Gene:
128 Products
Data Quality
  • 1
Type
  • 121
  • 7
Species
  • 52
  • 40
  • 28
  • 4
  • 2
Application
  • 71
  • 34
  • 27
  • 16
  • 1
Fusion tag
  • 46
  • 16
  • 14
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 51
  • 35
  • 16
  • 9
  • 8
Insert
  • 50
  • 34
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 55
  • 43
  • 18
  • 5
  • 2
Expression Type
  • 102
  • 54
  • 13
  • 2
Selectable Marker
  • 33
  • 26
  • 13
Promoter
  • 35
  • 31
  • 28
  • 17
  • 8
Format
  • 52
  • 36
  • 22
  • 18
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
3717 (Human, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098065
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
30307 (Zebrafish (Danio rerio), JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005206
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
16452 (Mouse (Murine), JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4099068
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
443637 (Xenopus laevis, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849127
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
100036599 (Xenopus tropicalis, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871643
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
100036599 (Xenopus tropicalis, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028005
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
3717 (Human, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804357
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Janus Kinase 2 (JAK2)
NCBI Accession:
NM_004972
Species:
Human
Synonyms:
jak2b, JAK2, Jak2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888420
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Janus Kinase 2
Species:
Human
Synonyms:
JAK2bCA, jak2, JTK10, THCYT3, AI504024, C81284, Fd17, JAK-2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189438
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
30307 (Zebrafish (Danio rerio), JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005207
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
100036599 (Xenopus tropicalis, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028004
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
100036599 (Xenopus tropicalis, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871642
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
3717 (Human, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804358
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
443637 (Xenopus laevis, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849128
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
16452 (Mouse (Murine), JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4099067
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Janus Kinase 2
Species:
Human
Synonyms:
JAK2bCA, jak2, JTK10, THCYT3, AI504024, C81284, Fd17, JAK-2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • JAK2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3342278
$300.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Janus Kinase 2 (JAK2)
Gene ID:
3717 (Human, JAK2)
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412136
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Janus Kinase 2 (JAK2)
Species:
Human
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751144
$375.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Janus Kinase 2 (JAK2)
NCBI Accession:
NM_004972
Species:
Human
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913351
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 30 to 41 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Janus Kinase 2 (JAK2)
NCBI Accession:
NM_004972
Species:
Human
Synonyms:
jak2b, JAK2, Jak2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3913344
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 30 to 41 Business Days
  • <
  • 1

Synonyms and alternative names related to JAK2

  • Janus kinase 2b (jak2b)
  • Janus kinase 2 (JAK2)
  • Janus kinase 2 (Jak2)
  • AI504024
  • C81284
  • Fd17
  • JAK-2
  • jak2
  • JAK2bCA
  • JTK10
  • THCYT3

Gene-IDs for different species

GENE IDSPECIES
30298 Danio rerio
3717 Homo sapiens
16452 Mus musculus
24514 Rattus norvegicus
374199 Gallus gallus
484185 Canis lupus familiaris
397201 Sus scrofa
525246 Bos taurus
464979 Pan troglodytes
100172517 Pongo abelii
100051487 Equus caballus

Protein level used designations for JAK2

  • Jak2b kinase
  • PTK JAK2b
  • protein tyrosine kinase JAK2b
  • tyrosine-protein kinase JAK2
  • JAK-2
  • Janus kinase 2 (a protein tyrosine kinase)
  • tyrosine kinase
Other products related to JAK2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com