MMP12 (Matrix Metallopeptidase 12 (Macrophage Elastase), MMP12)

Short Description: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. It is thought that the protein encoded by this gene is cleaved at both ends to yield the active enzyme, but this processing has not been fully described. The enzyme degrades soluble and insoluble elastin. It may play a role in aneurysm formation and studies in mice suggest a role in the development of emphysema. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008].
More information related to gene MMP12.
Products related to MMP12 Gene:
123 Products
Data Quality
  • 1
Type
  • 118
  • 5
Species
  • 54
  • 40
  • 29
Application
  • 72
  • 25
  • 25
  • 16
  • 1
Fusion tag
  • 40
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 50
  • 36
  • 12
  • 9
  • 7
Insert
  • 45
  • 36
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 54
  • 40
  • 18
  • 6
  • 2
Expression Type
  • 88
  • 50
  • 22
Selectable Marker
  • 29
  • 26
  • 22
  • 1
Promoter
  • 32
  • 31
  • 31
  • 13
  • 8
Format
  • 59
  • 27
  • 22
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
17381 (Mouse (Murine), MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216095
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
117033 (Rat (Rattus), MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048003
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999771
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999769
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
NCBI Accession:
NM_002426
Species:
Human
Synonyms:
MMP12, Mmp12
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103916
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase)
Species:
Human
Synonyms:
MMP12, AV378681, Mmel, Mme, HME, ME, MME, MMP-12
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188649
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
17381 (Mouse (Murine), MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216096
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
117033 (Rat (Rattus), MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048004
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999772
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999770
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Insert length:
1413 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324833
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3427977
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
Gene ID:
4321 (Human, MMP12)
Synonyms:
MMP12, Mmp12
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414670
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
NCBI Accession:
NM_002426,NP_002417
Species:
Human
Synonyms:
MMP12, Mmp12
Insert length:
1413 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5451677
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
NCBI Accession:
NM_008605
Species:
Mouse (Murine)
Synonyms:
MMP12, Mmp12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mmp12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5148699
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
NCBI Accession:
NM_053963
Species:
Rat (Rattus)
Synonyms:
MMP12, Mmp12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mmp12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5148701
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase) (MMP12)
NCBI Accession:
NM_002426
Species:
Human
Synonyms:
MMP12, Mmp12
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MMP12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5148697
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase)
Species:
Mouse (Murine)
Synonyms:
MMP12, AV378681, Mmel, Mme, HME, ME, MME, MMP-12
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mmp12 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3271380
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase)
Species:
Rat (Rattus)
Synonyms:
MMP12, AV378681, Mmel, Mme, HME, ME, MME, MMP-12
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mmp12 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3352481
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Matrix Metallopeptidase 12 (Macrophage Elastase)
Species:
Human
Synonyms:
MMP12, AV378681, Mmel, Mme, HME, ME, MME, MMP-12
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MMP12 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3342712
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to MMP12

  • matrix metallopeptidase 12 (MMP12)
  • matrix metallopeptidase 12 (Mmp12)
  • AV378681
  • HME
  • ME
  • Mme
  • MME
  • Mmel
  • MMP-12
  • MMP12

Gene-IDs for different species

GENE IDSPECIES
451512 Pan troglodytes
17381 Mus musculus
117033 Rattus norvegicus
4321 Homo sapiens
100009559 Oryctolagus cuniculus
611789 Canis lupus familiaris
526981 Bos taurus

Protein level used designations for MMP12

  • matrix metallopeptidase 12 (macrophage elastase)
  • matrix metalloproteinase 12
  • MME
  • MMP-12
  • macrophage elastase
  • macrophage metalloelastase
  • macrophage-metalloelastase
  • matrix metalloproteinase-12
  • matrix metalloproteinase 12 (macrophage elastase)
  • macrophage metalloelastase MMP-12
Other products related to MMP12 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com