MRPL4 (Mitochondrial Ribosomal Protein L4, MRPL4)

Short Description: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified alternatively spliced variants that encode different protein isoforms. [provided by RefSeq, Jul 2008].
More information related to gene MRPL4.
Products related to MRPL4 Gene:
141 Products
Type
  • 138
  • 3
Species
  • 65
  • 44
  • 26
  • 2
  • 2
Application
  • 85
  • 37
  • 23
  • 16
Fusion tag
  • 46
  • 21
  • 16
  • 14
  • 8
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 55
  • 44
  • 16
  • 10
  • 9
Insert
  • 52
  • 50
  • 20
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 54
  • 45
  • 32
  • 7
  • 2
Expression Type
  • 115
  • 58
  • 13
Selectable Marker
  • 32
  • 26
  • 13
  • 1
Promoter
  • 47
  • 30
  • 27
  • 17
  • 8
Format
  • 59
  • 36
  • 26
  • 20
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Species:
Human
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5748274
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Species:
Human
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5748275
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
NCBI Accession:
NM_146388,NP_666500
Species:
Human
Synonyms:
MRPL4, Mrpl4, mrpl4
Insert length:
792 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5426901
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
66163 (Mouse (Murine), MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819727
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
66163 (Mouse (Murine), MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4038383
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
100380997 (Xenopus laevis, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071142
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090783
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
507154 (Cow (Bovine), MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855253
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090780
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
NCBI Accession:
NM_023167
Species:
Mouse (Murine)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562495
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
66163 (Mouse (Murine), MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819728
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
66163 (Mouse (Murine), MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4038384
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
507154 (Cow (Bovine), MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855252
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090781
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090782
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
100380997 (Xenopus laevis, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071143
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Insert length:
792 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319120
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Insert length:
936 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312091
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
NCBI Accession:
NM_015956,NP_057040
Species:
Human
Synonyms:
MRPL4, Mrpl4, mrpl4
Insert length:
1250 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948185

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3393647
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L4 (MRPL4)
Gene ID:
51073 (Human, MRPL4)
Synonyms:
MRPL4, Mrpl4, mrpl4
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3409875
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to MRPL4

  • mitochondrial ribosomal protein L4 (MRPL4)
  • mitochondrial ribosomal protein L4 (Mrpl4)
  • mitochondrial ribosomal protein L4 (mrpl4)
  • 1110017G11Rik
  • CGI-28
  • L4mt
  • mrpl4
  • zgc:110034

Gene-IDs for different species

GENE IDSPECIES
51073 Homo sapiens
66163 Mus musculus
507154 Bos taurus
553771 Danio rerio

Protein level used designations for MRPL4

  • 39S ribosomal protein L4, mitochondrial
  • MRP-L4
  • L4mt
Other products related to MRPL4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com