MTOR (Mechanistic Target of Rapamycin (serine/threonine Kinase), FRAP1)

Short Description: The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008].
More information related to gene MTOR.
Products related to MTOR Gene:
73 Products
Data Quality
  • 2
Type
  • 69
  • 4
Species
  • 25
  • 25
  • 23
Application
  • 32
  • 24
  • 16
  • 14
  • 1
Fusion tag
  • 28
  • 9
  • 8
  • 7
  • 4
Vector Backbone
  • 6
  • 6
  • 6
  • 3
  • 3
Vector
  • 24
  • 24
  • 9
  • 8
  • 4
Insert
  • 23
  • 21
  • 9
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 32
  • 28
  • 7
  • 2
  • 2
Expression Type
  • 63
  • 44
  • 4
Selectable Marker
  • 26
  • 20
  • 4
  • 2
Promoter
  • 31
  • 14
  • 11
  • 9
  • 8
Format
  • 30
  • 18
  • 17
  • 8

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
56717 (Mouse (Murine), FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3817514
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
2475 (Human, FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996202
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase)
Species:
Human
Synonyms:
FRAP1, FRAP, FRAP2, RAFT1, RAPT1, 2610315D21Rik, AI327068, Frap1, flat, frap1, tor, wu:fc22h08
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190001
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
56717 (Mouse (Murine), FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3817513
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
2475 (Human, FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996201
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase)
Species:
Mouse (Murine)
Synonyms:
FRAP1, FRAP, FRAP2, RAFT1, RAPT1, 2610315D21Rik, AI327068, Frap1, flat, frap1, tor, wu:fc22h08
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Frap1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3350368
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase)
Species:
Rat (Rattus)
Synonyms:
FRAP1, FRAP, FRAP2, RAFT1, RAPT1, 2610315D21Rik, AI327068, Frap1, flat, frap1, tor, wu:fc22h08
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Frap1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3354047
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_019906
Species:
Rat (Rattus)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mtor
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137322
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_004958
Species:
Human
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MTOR
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137318
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_020009
Species:
Mouse (Murine)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mtor
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5137320
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
2475 (Human, FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5052312

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5033367
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase)
Gene ID:
2475 (Human, FRAP1)
Synonyms:
FRAP1, FRAP, FRAP2, RAFT1, RAPT1, 2610315D21Rik, AI327068, Frap1, flat, frap1, tor, wu:fc22h08
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5796215
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_004958
Species:
Human
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MTOR
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5252789
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_020009
Species:
Mouse (Murine)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mtor
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5252791
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_019906
Species:
Rat (Rattus)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mtor
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5252793
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_004958
Species:
Human
Synonyms:
MTOR, Mtor, mtor
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948153

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3924156
$655.88
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_004958
Species:
Human
Synonyms:
MTOR, Mtor, mtor
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3924157
$655.88
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
NCBI Accession:
NM_004958
Species:
Human
Synonyms:
MTOR, Mtor, mtor
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3924155
$655.88
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
56717 (Mouse (Murine), FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4117398

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4117397
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mechanistic Target of Rapamycin (serine/threonine Kinase) (FRAP1)
Gene ID:
56718 (Rat (Rattus), FRAP1)
Synonyms:
MTOR, Mtor, mtor
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4117398

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4117400
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to MTOR

  • mechanistic target of rapamycin kinase (MTOR)
  • mechanistic target of rapamycin (MTOR)
  • mechanistic target of rapamycin (serine/threonine kinase) (Mtor)
  • mechanistic target of rapamycin kinase (Mtor)
  • mechanistic target of rapamycin kinase (mtor)
  • 2610315D21Rik
  • AI327068
  • flat
  • FRAP
  • FRAP1
  • Frap1
  • frap1
  • FRAP2
  • RAFT1
  • RAPT1
  • tor
  • wu:fc22h08

Gene-IDs for different species

GENE IDSPECIES
100051341 Equus caballus
419455 Gallus gallus
2475 Homo sapiens
56717 Mus musculus
56718 Rattus norvegicus
324254 Danio rerio
478232 Canis lupus familiaris
100127359 Sus scrofa
100139219 Bos taurus
100860902 Capra hircus
100271659 Ovis aries

Protein level used designations for MTOR

  • FK506 binding protein 12-rapamycin associated protein 1
  • FK506 binding protein 12-rapamycin associated protein 2
  • FK506-binding protein 12-rapamycin complex-associated protein 1
  • FKBP-rapamycin associated protein
  • FKBP12-rapamycin complex-associated protein 1
  • mammalian target of rapamycin
  • rapamycin and FKBP12 target 1
  • rapamycin associated protein FRAP2
  • rapamycin target protein 1
  • serine/threonine-protein kinase mTOR
  • FKBP-rapamycin associated protein (FRAP)
  • FKBP-rapamycin-associated protein FRAP
  • FKBP12-rapamycin complex-associated protein
  • angiopoietin-like factor CDT6
  • RAPT1
  • rapamycin and FKBP12 target-1 protein
  • target of rapamycin
Other products related to MTOR such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com