Myogenin (Myogenin (Myogenic Factor 4), MYOG)

Short Description: Myogenin is a muscle-specific transcription factor that can induce myogenesis in a variety of cell types in tissue culture. It is a member of a large family of proteins related by sequence homology, the helix-loop-helix (HLH) proteins. It is essential for the development of functional skeletal muscle. [provided by RefSeq, Jul 2008].
More information related to gene Myogenin.
Products related to Myogenin Gene:
132 Products
Data Quality
  • 1
Type
  • 127
  • 5
Species
  • 54
  • 44
  • 26
  • 2
  • 2
Application
  • 83
  • 29
  • 25
  • 16
  • 1
Fusion tag
  • 45
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 60
  • 36
  • 12
  • 9
  • 4
Insert
  • 47
  • 43
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 60
  • 45
  • 20
  • 2
  • 2
Expression Type
  • 91
  • 50
  • 26
  • 2
Selectable Marker
  • 27
  • 26
  • 26
  • 1
Promoter
  • 42
  • 31
  • 31
  • 13
  • 8
Format
  • 64
  • 24
  • 22
  • 22

Type:
ORF
Application:
Protein Expression
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
NCBI Accession:
NM_002479,NP_002470
Species:
Human
Synonyms:
MYOG, myog, LOC100303673, Myog
Insert length:
675 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5381717
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
NCBI Accession:
NM_002479
Gene ID:
4656 (Human, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Insert length:
675 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4937427
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
30200 (Zebrafish (Danio rerio), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037251
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
17928 (Mouse (Murine), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875452
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
17928 (Mouse (Murine), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875451
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
4656 (Human, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464030
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
373806 (Xenopus laevis, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017891
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
549479 (Xenopus tropicalis, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4027084
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
281343 (Cow (Bovine), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048926
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
NCBI Accession:
NM_031189
Species:
Mouse (Murine)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562644
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Species:
Human
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562643
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Myogenin (Myogenic Factor 4)
Species:
Human
Synonyms:
cb553, zgc:100763, LOC446037, myf4, Xmyog, myogenin, LOC100136471, LOC100224062, LOC100303673, MYF4, bHLHc3, myo, myf-4
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192199
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
30200 (Zebrafish (Danio rerio), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037250
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
4656 (Human, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464031
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
373806 (Xenopus laevis, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017890
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
549479 (Xenopus tropicalis, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4027083
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
281343 (Cow (Bovine), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048925
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
17928 (Mouse (Murine), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216222
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
17928 (Mouse (Murine), MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216221
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Myogenin (Myogenic Factor 4) (MYOG)
Gene ID:
4656 (Human, MYOG)
Synonyms:
MYOG, myog, LOC100303673, Myog
Insert length:
675 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320609
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to Myogenin

  • myogenin (MYOG)
  • myogenin (myog)
  • myogenin (myogenic factor 4) (myog)
  • myogenin (LOC100303673)
  • myogenin (Myog)
  • bHLHc3
  • cb553
  • LOC446037
  • LOC100136471
  • LOC100224062
  • LOC100303673
  • myf-4
  • myf4
  • MYF4
  • myo
  • myogenin
  • Xmyog
  • zgc:100763

Gene-IDs for different species

GENE IDSPECIES
443158 Ovis aries
30200 Danio rerio
446037 Takifugu rubripes
549479 Xenopus (Silurana) tropicalis
100136471 Salmo salar
100224062 Taeniopygia guttata
100303673 Meleagris gallopavo
100534575 Oreochromis niloticus
29148 Rattus norvegicus
17928 Mus musculus
4656 Homo sapiens
490224 Canis lupus familiaris
497618 Sus scrofa
281343 Bos taurus
374004 Gallus gallus
100415937 Oryctolagus cuniculus
100727419 Cavia porcellus

Protein level used designations for Myogenin

  • myogenin
  • Myf4
  • myogenin (myogenic factor 4)
  • MYOD1-related protein
  • class C basic helix-loop-helix protein 3
  • myogenic factor 4
  • myogenic factor
Other products related to Myogenin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com