NAA30 (N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit, NAA30)

Short Description: Catalytic subunit of the N-terminal acetyltransferase C (NatC) complex. Catalyzes acetylation of the N-terminal methionine residues of peptides beginning with Met-Leu-Ala and Met-Leu-Gly. Necessary for the lysosomal localization and function of ARL8B.
More information related to gene NAA30.
Products related to NAA30 Gene:
94 Products
Type
  • 91
  • 3
Species
  • 44
  • 25
  • 21
  • 4
Application
  • 56
  • 20
  • 19
  • 17
Fusion tag
  • 35
  • 14
  • 11
  • 8
  • 5
Vector Backbone
  • 8
  • 8
  • 5
  • 5
  • 4
Vector
  • 34
  • 31
  • 10
  • 9
  • 6
Insert
  • 29
  • 28
  • 14
  • 10
  • 8
Oligo-Type
  • 3
Resistance Gene
  • 41
  • 30
  • 16
  • 4
  • 2
Expression Type
  • 74
  • 43
  • 13
Selectable Marker
  • 26
  • 22
  • 13
Promoter
  • 34
  • 24
  • 20
  • 10
  • 10
Format
  • 43
  • 23
  • 23
  • 5

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
Gene ID:
100192212 (Zebrafish (Danio rerio), NAA30)
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878668
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
Gene ID:
100192212 (Zebrafish (Danio rerio), NAA30)
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026618
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562667
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
Gene ID:
100192212 (Zebrafish (Danio rerio), NAA30)
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874673
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
Gene ID:
100192212 (Zebrafish (Danio rerio), NAA30)
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026619
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
Gene ID:
122830 (Human, NAA30)
Synonyms:
NAA30, Naa30, naa30.S
Insert length:
1089 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325304
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958157
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958153
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958155
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958159
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958156
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958161
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958163
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958162
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958165
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948176

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958154
$314.71
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948177

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958160
$314.71
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-OFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
OFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948175

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958158
$314.71
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001011713
Species:
Human
Synonyms:
NAA30, Naa30, naa30.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-OFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
OFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948174

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3958164
$314.71
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N(alpha)-Acetyltransferase 30, NatC Catalytic Subunit (NAA30)
NCBI Accession:
NM_001109099,NP_001102569
Species:
Rat (Rattus)
Synonyms:
NAA30, Naa30, naa30.S
Insert length:
1089 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331702
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
  • <
  • 1

Synonyms and alternative names related to NAA30

  • N(alpha)-acetyltransferase 30, NatC catalytic subunit (NAA30)
  • N(alpha)-acetyltransferase 30, NatC catalytic subunit (Naa30)
  • N(alpha)-acetyltransferase 30, NatC catalytic subunit S homeolog (naa30.S)
  • 4930487N19Rik
  • 5730533P17Rik
  • AI447922
  • AW322455
  • C14orf35
  • MAK3
  • mak3
  • Mak3p
  • mak3p
  • NAT12
  • Nat12
  • nat12
  • RGD1559923

Gene-IDs for different species

GENE IDSPECIES
122830 Homo sapiens
533922 Bos taurus
70646 Mus musculus
498489 Rattus norvegicus
779222 Xenopus laevis

Protein level used designations for NAA30

  • N-acetyltransferase 12 (GCN5-related, putative)
  • N-acetyltransferase MAK3 homolog
  • N-alpha-acetyltransferase 30
  • N-alpha-acetyltransferase 30, NatC catalytic subunit
  • natC catalytic subunit
  • putative N-acetyltransferase
  • N-acetyltransferase 12
  • Nalpha acetyltransferase 30
Other products related to NAA30 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com