OR10G7 (Olfactory Receptor, Family 10, Subfamily G, Member 7, OR10G7)

Short Description: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008].
More information related to gene OR10G7.
Products related to OR10G7 Gene:
23 Products
Type
  • 22
  • 1
Species
  • 23
Application
  • 12
  • 8
  • 7
Fusion tag
  • 7
  • 6
  • 4
  • 4
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
Vector
  • 13
  • 6
  • 3
Insert
  • 7
  • 7
  • 3
  • 2
  • 2
Oligo-Type
  • 1
Resistance Gene
  • 12
  • 6
  • 4
  • 2
Expression Type
  • 22
  • 15
Selectable Marker
  • 10
  • 6
Promoter
  • 12
  • 8
  • 4
  • 2
  • 2
Format
  • 13
  • 8
  • 2
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463,NP_001004463
Species:
Human
Synonyms:
OR10G7
Insert length:
936 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5468425
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7
Species:
Human
Synonyms:
OR11-283
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • OR10G7 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3315161
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR10G7
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5158829
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Gene ID:
390265 (Human, OR10G7)
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5055627

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5036682
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR10G7
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5274409
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5468424
$560.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463,NP_001004463
Species:
Human
Synonyms:
OR10G7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3303235
$640.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463,NP_001004463
Species:
Human
Synonyms:
OR10G7
Insert length:
936 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5468427
$700.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Gene ID:
390265 (Human, OR10G7)
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4197800

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4197799
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3715521
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948187

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3735860
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948189

Components:
  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3652957
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Gene ID:
390265 (Human, OR10G7)
Synonyms:
OR10G7
Vector type:
Mammalian Expression Vector
Vector backbone:
pU6-GFP-Neo
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter, U6 Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
This product contains 3 separate slightly different shRNA sequences which knock down human OR10G7 gene specifically. Each vial contains 50 μg of lyophilized shRNA.
Format:
Lyophilized
Storage:
4 °C,-20 °C,-80 °C
Catalog No. ABIN5837607
$749.44
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463,NP_001004463
Species:
Human
Synonyms:
OR10G7
Insert length:
936 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5468426
$760.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pGFP-C-shLenti
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948186

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3756198
$815.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of OR10G7
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5158828
$920.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
Lentiviral particles with guaranteed titer of >10^7 TU/mL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN6413180
$1,082.42
200 μL
Plus shipping costs $45.00 and $22.60 dry ice
Delivery in 25 to 30 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • OR10G7 gRNA vector 1 in pCAS-Guide vector.
  • OR10G7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3228978
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
NCBI Accession:
NM_001004463
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of OR10G7
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5274408
$1,200.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 10, Subfamily G, Member 7 (OR10G7)
Species:
Human
Synonyms:
OR10G7
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Components:
Lentiviral particles with guaranteed titer of >10^7 TU/mL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN6413181
$1,213.26
200 μL
Plus shipping costs $45.00 and $22.60 dry ice
Delivery in 25 to 30 Business Days
  • <
  • 1

Synonyms and alternative names related to OR10G7

  • olfactory receptor family 10 subfamily G member 7 (OR10G7)
  • OR11-283

Gene-IDs for different species

GENE IDSPECIES
390265 Homo sapiens

Protein level used designations for OR10G7

  • olfactory receptor 10G7
  • olfactory receptor OR11-283
Other products related to OR10G7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com