PAK2 (P21-Activated Kinase 2, PAK2)

Short Description: The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell. [provided by RefSeq, Jul 2008].
More information related to gene PAK2.
Products related to PAK2 Gene:
109 Products
Data Quality
  • 1
Type
  • 105
  • 4
Species
  • 50
  • 29
  • 26
  • 4
Application
  • 59
  • 25
  • 24
  • 16
  • 1
Fusion tag
  • 37
  • 15
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 42
  • 33
  • 12
  • 9
  • 7
Insert
  • 37
  • 31
  • 21
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 46
  • 39
  • 16
  • 4
  • 2
Expression Type
  • 86
  • 49
  • 13
Selectable Marker
  • 26
  • 25
  • 13
Promoter
  • 31
  • 29
  • 21
  • 14
  • 8
Format
  • 50
  • 27
  • 20
  • 12
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5741118
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
325034 (Zebrafish (Danio rerio), PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4072533
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
266749 (Zebrafish (Danio rerio), PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048755
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
NCBI Accession:
NM_002577
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3625562
$102.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
5062 (Human, PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095446
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
224105 (Mouse (Murine), PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102526
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
P21-Activated Kinase 2
Species:
Human
Synonyms:
PAK65, PAKgamma, gamma-PAK, 5330420P17Rik, A130002K10Rik, AI836325, D16Ertd269e, PAK-2, mKIAA4182, pak2, cb422, kinase, zgc:91798, wu:fb71h01, si:dz198m22.1, pak65, pakgamma, PAKI, Pak3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188506
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
325034 (Zebrafish (Danio rerio), PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4072534
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
266749 (Zebrafish (Danio rerio), PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048756
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
5062 (Human, PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095447
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
224105 (Mouse (Murine), PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102525
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Gene ID:
5062 (Human, PAK2)
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321949
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440176
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4479081
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4837007
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770749
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4707877
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
P21-Activated Kinase 2 (PAK2)
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622552
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
P21-Activated Kinase 2 (PAK2)
NCBI Accession:
NM_002577
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3625549
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
P21-Activated Kinase 2 (PAK2)
NCBI Accession:
NM_002577
Species:
Human
Synonyms:
PAK2, Pak2, pak2a, pak2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3625552
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to PAK2

  • p21 (RAC1) activated kinase 2 (PAK2)
  • p21 protein (Cdc42/Rac)-activated kinase 2 (Pak2)
  • p21 protein (Cdc42/Rac)-activated kinase 2a (pak2a)
  • p21 protein (Cdc42/Rac)-activated kinase 2 S homeolog (pak2.S)
  • p21 (RAC1) activated kinase 2 (Pak2)
  • 5330420P17Rik
  • A130002K10Rik
  • AI836325
  • cb422
  • D16Ertd269e
  • gamma-PAK
  • kinase
  • mKIAA4182
  • PAK-2
  • pak2
  • Pak3
  • pak65
  • PAK65
  • PAKgamma
  • pakgamma
  • PAKI
  • si:dz198m22.1
  • wu:fb71h01
  • zgc:91798

Gene-IDs for different species

GENE IDSPECIES
5062 Homo sapiens
29432 Rattus norvegicus
224105 Mus musculus
266749 Danio rerio
399090 Xenopus laevis
460965 Pan troglodytes
100009535 Oryctolagus cuniculus
513673 Bos taurus
424860 Gallus gallus
612814 Canis lupus familiaris
100713135 Cavia porcellus

Protein level used designations for PAK2

  • PAK-2
  • S6/H4 kinase
  • gamma-PAK
  • p21 (CDKN1A)-activated kinase 2
  • p21-activated kinase 2
  • p58
  • serine/threonine-protein kinase PAK 2
  • redhead
  • rhd
  • p21 activated kinase 2
  • p21-activated kinase I
  • p21-activated protein kinase I
Other products related to PAK2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com