PIK3C3 (Phosphoinositide-3-Kinase, Class 3, PIK3C3)

Short Description: Catalytic subunit of the PI3K complex that mediates formation of phosphatidylinositol 3-phosphate which plays a key role in initiation and maturation of autophagosomes. Involved in the transport of lysosomal enzyme precursors to lysosomes. Required for the abcission step in cytokinesis (By similarity).
More information related to gene PIK3C3.
Products related to PIK3C3 Gene:
114 Products
Data Quality
  • 4
Type
  • 111
  • 3
Species
  • 40
  • 38
  • 28
  • 4
  • 2
Application
  • 67
  • 33
  • 24
  • 18
Fusion tag
  • 47
  • 18
  • 12
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 8
  • 8
  • 6
Vector
  • 41
  • 40
  • 12
  • 9
  • 7
Insert
  • 46
  • 26
  • 21
  • 10
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 47
  • 37
  • 24
  • 3
  • 2
Expression Type
  • 105
  • 52
Selectable Marker
  • 28
  • 27
Promoter
  • 36
  • 33
  • 18
  • 13
  • 10
Format
  • 37
  • 27
  • 26
  • 24
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
548346 (Zebrafish (Danio rerio), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4043589
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
548346 (Zebrafish (Danio rerio), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4077296
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
446671 (Xenopus laevis, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851465
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
65052 (Rat (Rattus), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879445
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
534815 (Cow (Bovine), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064354
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
5289 (Human, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211316
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
5289 (Human, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804890
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
225326 (Mouse (Murine), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3835419
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
225326 (Mouse (Murine), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3835416
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
548346 (Zebrafish (Danio rerio), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4043590
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
548346 (Zebrafish (Danio rerio), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4077297
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
65052 (Rat (Rattus), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879447
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
225326 (Mouse (Murine), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3835415
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
225326 (Mouse (Murine), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3835418
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
5289 (Human, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804889
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
446671 (Xenopus laevis, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851464
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
534815 (Cow (Bovine), PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064353
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
5289 (Human, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211315
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
NCBI Accession:
NM_002647,NP_002638
Species:
Human
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Insert length:
3420 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Mbengue, Bhattacharjee, Pandharkar, Liu, Estiu, Stahelin, Rizk, Njimoh, Ryan, Chotivanich, Nguon, Ghorbal, Lopez-Rubio, Pfrender, Emrich, Mohandas, Dondorp, Wiest, Haldar: "A molecular mechanism of artemisinin resistance in Plasmodium falciparum malaria." in: Nature, Vol. 520, Issue 7549, pp. 683-7, 2015 (Pubmed)
Catalog No. ABIN3385821
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Phosphoinositide-3-Kinase, Class 3 (PIK3C3)
Gene ID:
5289 (Human, PIK3C3)
Synonyms:
PIK3C3, pik3c3.L, pik3c3, Pik3c3
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3421549
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to PIK3C3

  • phosphatidylinositol 3-kinase catalytic subunit type 3 (PIK3C3)
  • phosphatidylinositol 3-kinase catalytic subunit type 3 L homeolog (pik3c3.L)
  • phosphatidylinositol 3-kinase, catalytic subunit type 3 (pik3c3)
  • phosphatidylinositol 3-kinase, catalytic subunit type 3 (Pik3c3)
  • phosphatidylinositol 3-kinase catalytic subunit type 3 (Pik3c3)
  • 5330434F23Rik
  • hVps34
  • im:7147158
  • VPS34
  • Vps34
  • wu:fc13g06
  • wu:fz51e12
  • zgc:112016
  • zgc:113009

Gene-IDs for different species

GENE IDSPECIES
100053039 Equus caballus
446671 Xenopus laevis
455385 Pan troglodytes
548346 Danio rerio
5289 Homo sapiens
503700 Sus scrofa
65052 Rattus norvegicus
490477 Canis lupus familiaris
534815 Bos taurus
225326 Mus musculus
100857877 Gallus gallus

Protein level used designations for PIK3C3

  • phosphoinositide-3-kinase, class 3
  • phosphatidylinositol 3-kinase catalytic subunit type 3
  • PI3K type 3
  • PI3-kinase type 3
  • ptdIns-3-kinase type 3
  • phosphoinositide-3-kinase class 3
  • catalytic phosphatidylinositol 3-kinase 3
  • PtdIns-3-kinase type 3
  • phosphatidylinositol 3-kinase p100 subunit
  • class 3 phosphoinositide-3-kinase
  • PI-3K Vps34p
Other products related to PIK3C3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com