PTK2B (PTK2B Protein tyrosine Kinase 2 beta, PTK2B)

Short Description: This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene PTK2B.
Products related to PTK2B Gene:
152 Products
Type
  • 148
  • 4
Species
  • 59
  • 58
  • 29
  • 2
  • 2
Application
  • 89
  • 42
  • 25
  • 16
Fusion tag
  • 51
  • 27
  • 21
  • 15
  • 8
Vector Backbone
  • 14
  • 14
  • 9
  • 6
  • 6
Vector
  • 54
  • 51
  • 20
  • 13
  • 9
Insert
  • 66
  • 45
  • 21
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 55
  • 53
  • 34
  • 6
  • 2
Expression Type
  • 139
  • 62
Selectable Marker
  • 46
  • 26
Promoter
  • 62
  • 31
  • 24
  • 20
  • 8
Format
  • 59
  • 45
  • 28
  • 20

Type:
ORF
Application:
Protein Expression
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
NCBI Accession:
NM_173174,NP_775266
Species:
Human
Synonyms:
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5423278
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
NCBI Accession:
NM_004103,NP_004094
Species:
Human
Synonyms:
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5423277
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
386705 (Zebrafish (Danio rerio), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018566
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803938
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
50646 (Rat (Rattus), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879229
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003624
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003625
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
541008 (Cow (Bovine), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065153
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
496459 (Xenopus tropicalis, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983301
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210974
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
386705 (Zebrafish (Danio rerio), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018567
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Species:
Human
Synonyms:
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5747180
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803939
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
50646 (Rat (Rattus), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879230
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003626
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003627
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
541008 (Cow (Bovine), PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065154
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
496459 (Xenopus tropicalis, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983300
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210975
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
Synonyms:
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320076
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to PTK2B

  • protein tyrosine kinase 2 beta (PTK2B)
  • PTK2 protein tyrosine kinase 2 beta (Ptk2b)
  • protein tyrosine kinase 2 beta (Ptk2b)
  • protein tyrosine kinase 2aa (ptk2aa)
  • CADTK
  • CAKB
  • CAKbeta
  • E430023O05Rik
  • FADK2
  • fak1b
  • FAK2
  • PKB
  • PTK
  • ptk2.2
  • ptk2b
  • PYK2
  • Pyk2
  • RAFTK
  • Raftk
  • si:ch1073-355e8.1

Gene-IDs for different species

GENE IDSPECIES
2185 Homo sapiens
421998 Gallus gallus
486102 Canis lupus familiaris
100342358 Oryctolagus cuniculus
19229 Mus musculus
50646 Rattus norvegicus
541008 Bos taurus
100157507 Sus scrofa
100734027 Cavia porcellus
386705 Danio rerio

Protein level used designations for PTK2B

  • CAK-beta
  • FADK 2
  • PTK2B protein tyrosine kinase 2 beta
  • calcium-dependent tyrosine kinase
  • calcium-regulated non-receptor proline-rich tyrosine kinase
  • cell adhesion kinase beta
  • focal adhesion kinase 2
  • proline-rich tyrosine kinase 2
  • protein kinase B
  • protein-tyrosine kinase 2-beta
  • related adhesion focal tyrosine kinase
  • cellular adhesion kinase beta
  • protein tyrosine kinase 2 beta
  • CADTK
  • CAK beta
  • PTK2 protein tyrosine kinase 2 beta
  • fakb
  • protein tyrosine kinase 2.2
  • protein tyrosine kinase 2aa
  • protein tyrosine kinase 2b
Other products related to PTK2B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com