PTK2B (PTK2B Protein tyrosine Kinase 2 beta, PTK2B)

Short Description: This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene PTK2B.
Products related to PTK2B Gene:
152 Products
  • 148
  • 4
  • 59
  • 58
  • 29
  • 2
  • 2
  • 89
  • 42
  • 25
  • 16
Fusion tag
  • 51
  • 27
  • 21
  • 15
  • 8
Vector Backbone
  • 14
  • 14
  • 9
  • 6
  • 6
  • 54
  • 51
  • 20
  • 13
  • 9
  • 66
  • 45
  • 21
  • 8
  • 6
  • 4
Resistance Gene
  • 55
  • 53
  • 34
  • 6
  • 2
Expression Type
  • 139
  • 62
Selectable Marker
  • 46
  • 26
  • 62
  • 31
  • 24
  • 20
  • 8
  • 59
  • 45
  • 28
  • 20

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5747180
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
NCBI Accession:
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5423277
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
NCBI Accession:
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5423278
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
386705 (Zebrafish (Danio rerio), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4018566
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4210974
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
541008 (Cow (Bovine), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065153
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3803938
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
50646 (Rat (Rattus), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879229
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
496459 (Xenopus tropicalis, PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3983301
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003624
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003625
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
386705 (Zebrafish (Danio rerio), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4018567
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4210975
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
541008 (Cow (Bovine), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065154
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3803939
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
50646 (Rat (Rattus), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879230
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
496459 (Xenopus tropicalis, PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3983300
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003626
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
19229 (Mouse (Murine), PTK2B)
PTK2B, Ptk2b, ptk2aa
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003627
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

PTK2B Protein tyrosine Kinase 2 beta (PTK2B)
Gene ID:
2185 (Human, PTK2B)
PTK2B, Ptk2b, ptk2aa
Insert length:
3030 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5320076
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to PTK2B

  • protein tyrosine kinase 2 beta (PTK2B)
  • PTK2 protein tyrosine kinase 2 beta (Ptk2b)
  • protein tyrosine kinase 2 beta (Ptk2b)
  • protein tyrosine kinase 2aa (ptk2aa)
  • CAKB
  • CAKbeta
  • E430023O05Rik
  • FADK2
  • fak1b
  • FAK2
  • PKB
  • PTK
  • ptk2.2
  • ptk2b
  • PYK2
  • Pyk2
  • Raftk
  • si:ch1073-355e8.1

Gene-IDs for different species

2185 Homo sapiens
421998 Gallus gallus
486102 Canis lupus familiaris
100342358 Oryctolagus cuniculus
19229 Mus musculus
50646 Rattus norvegicus
541008 Bos taurus
100157507 Sus scrofa
100734027 Cavia porcellus
386705 Danio rerio

Protein level used designations for PTK2B

  • CAK-beta
  • FADK 2
  • PTK2B protein tyrosine kinase 2 beta
  • calcium-dependent tyrosine kinase
  • calcium-regulated non-receptor proline-rich tyrosine kinase
  • cell adhesion kinase beta
  • focal adhesion kinase 2
  • proline-rich tyrosine kinase 2
  • protein kinase B
  • protein-tyrosine kinase 2-beta
  • related adhesion focal tyrosine kinase
  • cellular adhesion kinase beta
  • protein tyrosine kinase 2 beta
  • CAK beta
  • PTK2 protein tyrosine kinase 2 beta
  • fakb
  • protein tyrosine kinase 2.2
  • protein tyrosine kinase 2aa
  • protein tyrosine kinase 2b
Other products related to PTK2B such as antibodies, ELISA kits and high-purity proteins are available on our partner website