REG3g (Regenerating Islet Derived Protein 3 gamma, REG3g)

Short Description: This gene encodes a member of the regenerating islet-derived genes (REG)3 protein family. These proteins are secreted, C-type lectins with a carbohydrate recognition domain and N-terminal signal peptide. The protein encoded by this gene is an antibacterial lectin with activity against Gram-positive bacteria. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012].
More information related to gene REG3g.
Products related to REG3g Gene:
132 Products
Type
  • 126
  • 6
Species
  • 64
  • 40
  • 26
  • 2
Application
  • 78
  • 25
  • 25
  • 16
  • 2
Fusion tag
  • 40
  • 20
  • 14
  • 13
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 53
  • 40
  • 12
  • 9
  • 8
Insert
  • 50
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 62
  • 38
  • 24
  • 2
  • 2
Expression Type
  • 92
  • 53
  • 22
Selectable Marker
  • 28
  • 26
  • 22
  • 6
  • 1
Promoter
  • 40
  • 31
  • 30
  • 13
  • 8
Format
  • 68
  • 24
  • 24
  • 16
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_001270040
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Insert length:
390 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4924429
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_198448
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4924428
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
19695 (Mouse (Murine), REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036674
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992248
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992249
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992250
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
513652 (Cow (Bovine), REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858506
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_011260
Species:
Mouse (Murine)
Synonyms:
REG3G, Reg3g
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564273
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Regenerating Islet Derived Protein 3 gamma
Species:
Mouse (Murine)
Synonyms:
LPPM429, PAP IB, PAP-1B, PAP1B, PAPIB, REG III, REG-III, UNQ429, AI449515, PAPIII, Pap3, REG3A
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194474
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Regenerating Islet Derived Protein 3 gamma
Species:
Human
Synonyms:
LPPM429, PAP IB, PAP-1B, PAP1B, PAPIB, REG III, REG-III, UNQ429, AI449515, PAPIII, Pap3, REG3A
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189825
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_001008387
Species:
Human
Synonyms:
REG3G, Reg3g
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644687
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
19695 (Mouse (Murine), REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036673
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992245
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992246
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992247
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
513652 (Cow (Bovine), REG3g)
Synonyms:
REG3G, Reg3g
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858507
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
Gene ID:
130120 (Human, REG3g)
Synonyms:
REG3G, Reg3g
Insert length:
528 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323807
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_011260
Species:
Mouse (Murine)
Synonyms:
REG3G, Reg3g
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644666
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_011260
Species:
Mouse (Murine)
Synonyms:
REG3G, Reg3g
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644672
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet Derived Protein 3 gamma (REG3g)
NCBI Accession:
NM_011260
Species:
Mouse (Murine)
Synonyms:
REG3G, Reg3g
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644674
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to REG3g

  • regenerating family member 3 gamma (REG3G)
  • regenerating islet-derived 3 gamma (Reg3g)
  • regenerating family member 3 gamma (Reg3g)
  • regenerating islet-derived 3 gamma (REG3G)
  • AI449515
  • LPPM429
  • PAP-1B
  • PAP1B
  • Pap3
  • PAP IB
  • PAPIB
  • PAPIII
  • REG-III
  • REG3A
  • REG III
  • UNQ429

Gene-IDs for different species

GENE IDSPECIES
130120 Homo sapiens
19695 Mus musculus
24620 Rattus norvegicus
100240745 Sus scrofa
513652 Bos taurus

Protein level used designations for REG3g

  • REG-3-gamma
  • pancreatitis-associated protein 1B
  • pancreatitis-associated protein IB
  • reg III-gamma
  • regenerating gene III
  • regenerating islet-derived protein 3-gamma
  • regenerating islet-derived protein III-gamma
  • RegIII (gamma)
  • generating islet-derived, mouse homolog 3 gamma
  • pancreatitis-associated protein 3
  • regenerating islet-derived protein 3 gamma
  • regenerating islet-derived family member 3
  • pancreatic thread protein
  • regenerating islet-derived 3 alpha
Other products related to REG3g such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com