XCR1 (Chemokine (C Motif) Receptor 1, XCR1)

Short Description: The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene XCR1.
Products related to XCR1 Gene:
101 Products
Type
  • 99
  • 2
Species
  • 45
  • 30
  • 26
Application
  • 52
  • 24
  • 21
  • 16
Fusion tag
  • 34
  • 17
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 40
  • 25
  • 12
  • 11
  • 9
Insert
  • 36
  • 28
  • 19
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 38
  • 34
  • 22
  • 5
  • 2
Expression Type
  • 89
  • 49
Selectable Marker
  • 26
  • 25
  • 4
  • 1
Promoter
  • 35
  • 29
  • 13
  • 8
  • 7
Format
  • 36
  • 27
  • 24
  • 14

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
2829 (Human, XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098249
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
23832 (Mouse (Murine), XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997013
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
23832 (Mouse (Murine), XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997014
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
2829 (Human, XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095291
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751756
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
NCBI Accession:
NM_011798
Species:
Mouse (Murine)
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
969 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751757
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
2829 (Human, XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098250
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
23832 (Mouse (Murine), XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997011
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
23832 (Mouse (Murine), XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997012
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
2829 (Human, XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095292
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
2829 (Human, XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321908
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4418125
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4483211
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4626682
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4714204
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4774903
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4843335
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
Gene ID:
2829 (Human, XCR1)
Synonyms:
XCR1, xcr1a.1, Xcr1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413313
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
NCBI Accession:
NM_001106871,NP_001100341
Species:
Rat (Rattus)
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1017 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373162
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C Motif) Receptor 1 (XCR1)
NCBI Accession:
NM_005283,NP_005274
Species:
Human
Synonyms:
XCR1, xcr1a.1, Xcr1
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5438409
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to XCR1

  • X-C motif chemokine receptor 1 (XCR1)
  • chemokine (C motif) receptor 1a, duplicate 1 (xcr1a.1)
  • chemokine (C motif) receptor 1 (Xcr1)
  • X-C motif chemokine receptor 1 (Xcr1)
  • CCXCR1
  • Ccxcr1
  • CCXCR1-L
  • GPR5
  • Gpr5
  • mXcr1
  • XCR1

Gene-IDs for different species

GENE IDSPECIES
414375 Sus scrofa
428452 Gallus gallus
460321 Pan troglodytes
484792 Canis lupus familiaris
553500 Danio rerio
617880 Bos taurus
713622 Macaca mulatta
100579780 Nomascus leucogenys
2829 Homo sapiens
23832 Mus musculus
301086 Rattus norvegicus
100352332 Oryctolagus cuniculus

Protein level used designations for XCR1

  • chemokine XC receptor 1
  • chemokine C motif receptor 1
  • CCXC chemokine receptor 1 like
  • XC chemokine receptor 1
  • chemokine (C motif) receptor 1
  • G protein-coupled receptor 5
  • G-protein coupled receptor 5
  • chemokine (C motif) XC receptor 1
  • lymphotactin receptor
  • C motif-1/lymphotactin receptor
  • SCM1 receptor
Other products related to XCR1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com