Plasmids

1 Product
Type
  • 1
    Plasmid
Insert
  • 1
Vector
  • 1
Vector Backbone
  • 1
Resistance Gene
  • 1
Selectable Marker
  • 1
Promoter
  • 1
Expression Type
  • 1
  • 1
Application
  • 1
  • 1
Format
  • 1
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948154
$126.50
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1
  • >