You are viewing an incomplete version of our website. Please click to reload the website as full version.

Plasmids

A plasmid is a small, circular, double-stranded DNA molecule within a cell that can replicate independently and is not not packaged inside a chromosome . They are common in bacteria and can sometimes be found in archaea or eukaryotic organisms aswell. Plasmid are of great use in biotechnology, they serve as vectors to amplify or express genetic information in foreign hosts. These plasmids will typically contain a multiple cloning site (MCS) to insert the desired sequence, an origin of replication (ORI) to duplicate in the host and selection mechanisms (e.g. antibiotic resistance) to verify the insertion process. The cloning vector is transferred into a robust host (e.g. E.coli) via transformation and greatly amplified within each cell.

Upon lysis the vector can be transferred to an expression vector. They contain an additional promoter sequence which encourage the local transcriptional machinery to transcribe an RNA template in order to produce the protein of interest.

Choose at genomics-online between different types of plasmid inserts. We provide you with ready-to-use shRNA Clones, ORF Clones, cDNA Clones and those specialized on the CRISPR/CAS9 system. For further questions regarding our products, please contact our customer service via phone, live chat, or email.

1,896,193 Products
Data Quality
  • 3015
Type
  • 1896193
    Plasmid
Gene
  • 1031
  • 382
  • 374
  • 345
  • 329
Species
  • 819092
  • 583915
  • 387828
  • 27772
  • 21907
Insert
  • 785884
  • 437354
  • 365420
  • 154625
  • 114972
Vector
  • 779667
  • 565441
  • 247252
  • 161881
  • 87096
Vector Backbone
  • 149571
  • 115473
  • 114972
  • 108735
  • 62463
Fusion tag
  • 636536
  • 216580
  • 187470
  • 183643
  • 135728
Resistance Gene
  • 846786
  • 799419
  • 215405
  • 34917
Selectable Marker
  • 518854
  • 514141
  • 179829
  • 14372
  • 9555
Promoter
  • 485443
  • 449902
  • 410583
  • 264117
  • 153319
Expression Type
  • 1264659
  • 652558
  • 486386
  • 3174
  • 10
Application
  • 1094811
  • 477854
  • 365420
  • 307515
  • 59
Supplier: Log in to see

Untagged full-length cDNA clone from Human IL8 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Interleukin 8
NCBI Accession:
NM_000584, NP_000575
Species:
Human
Synonyms:
IL8L1, il8, IL8, LOC422654, Cxcl15, Il8, IL8L2, IL*08-02
Insert length:
1690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Balakathiresan, Bhattacharyya, Gutti, Long, Jozwik, Huang, Srivastava, Pollard, Biswas: "Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 296, Issue 6, pp. L1012-8, 2009 (Pubmed)
Catalog No. ABIN3384619
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MDH1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Malate Dehydrogenase 1, NAD (Soluble)
NCBI Accession:
NM_005917, NP_005908
Species:
Human
Synonyms:
mdh5, LOC100280767, Mdh1, MDH1, mdh1
Insert length:
1370 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Stiebler, Freitag, Schink, Stehlik, Tillmann, Ast, Bölker: "Ribosomal readthrough at a short UGA stop codon context triggers dual localization of metabolic enzymes in Fungi and animals." in: PLoS genetics, Vol. 10, Issue 10, pp. e1004685, 2014 (Pubmed)
Catalog No. ABIN3385064
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOX is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lysyl Oxidase
NCBI Accession:
NM_002317, NP_002308
Species:
Human
Synonyms:
LOX, lox, Lox, LOC100357045
Insert length:
1870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ruiz, Báez-Vega, Ruiz, Peterse, Monteiro, Bracero, Beauchamp, Fazleabas, Flores: "Dysregulation of Lysyl Oxidase Expression in Lesions and Endometrium of Women With Endometriosis." in: Reproductive sciences (Thousand Oaks, Calif.), Vol. 22, Issue 12, pp. 1496-508, 2015 (Pubmed)
  • Okkelman, Sukaeva, Kirukhina, Korneenko, Pestov: "Nuclear translocation of lysyl oxidase is promoted by interaction with transcription repressor p66β." in: Cell and tissue research, Vol. 358, Issue 2, pp. 481-9, 2014 (Pubmed)
Catalog No. ABIN3384901
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOXL2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lysyl Oxidase-Like 2
NCBI Accession:
NM_002318, NP_002309
Species:
Human
Synonyms:
lox2, LOXL2, loxl2, Loxl2
Insert length:
3550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • de Jong, van Balkom, Gremmels, Verhaar: "Exosomes from hypoxic endothelial cells have increased collagen crosslinking activity through up-regulation of lysyl oxidase-like 2." in: Journal of cellular and molecular medicine, Vol. 20, Issue 2, pp. 342-50, 2016 (Pubmed)
  • Wong, Tse, Huang, Zhu, Chiu, Lai, Au, Kai, Lee, Wei, Tsang, Lo, Shi, Zheng, Wong, Ng: "Lysyl oxidase-like 2 is critical to tumor microenvironment and metastatic niche formation in hepatocellular carcinoma." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1645-58, 2014 (Pubmed)
  • Xu, Go, Finney, Moon, Lantz, Rebecchi, Desaire, Mure: "Post-translational modifications of recombinant human lysyl oxidase-like 2 (rhLOXL2) secreted from Drosophila S2 cells." in: The Journal of biological chemistry, Vol. 288, Issue 8, pp. 5357-63, 2013 (Pubmed)
  • Bignon, Pichol-Thievend, Hardouin, Malbouyres, Bréchot, Nasciutti, Barret, Teillon, Guillon, Etienne, Caron, Joubert-Caron, Monnot, Ruggiero, Muller, Germain: "Lysyl oxidase-like protein-2 regulates sprouting angiogenesis and type IV collagen assembly in the endothelial basement membrane." in: Blood, Vol. 118, Issue 14, pp. 3979-89, 2011 (Pubmed)
Catalog No. ABIN3384902
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAT2A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Methionine Adenosyltransferase II, alpha
NCBI Accession:
NM_005911, NP_005902
Species:
Human
Synonyms:
mat2a, MAT2A, Mat2a, mat2aa
Insert length:
2820 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Nordgren, Peng, Pelleymounter, Moon, Abo, Feng, Eckloff, Yee, Wieben, Weinshilboum: "Methionine adenosyltransferase 2A/2B and methylation: gene sequence variation and functional genomics." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 39, Issue 11, pp. 2135-47, 2011 (Pubmed)
Catalog No. ABIN3385037
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAX is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
MYC Associated Factor X
NCBI Accession:
NM_145112, NP_660087
Species:
Human
Synonyms:
Max, max-a, MAX, max, max-b
Insert length:
2210 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ikeda, Pak, Chavez, Ryan: "Transcription factors with conserved binding sites near ATOH1 on the POU4F3 gene enhance the induction of cochlear hair cells." in: Molecular neurobiology, Vol. 51, Issue 2, pp. 672-84, 2015 (Pubmed)
Catalog No. ABIN3385041
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MCCC1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Methylcrotonoyl-CoA Carboxylase 1 (Alpha)
NCBI Accession:
NM_020166, NP_064551
Species:
Human
Synonyms:
MCCC1, Mccc1, MCCA
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ingaramo, Beckett: "Selectivity in post-translational biotin addition to five human carboxylases." in: The Journal of biological chemistry, Vol. 287, Issue 3, pp. 1813-22, 2012 (Pubmed)
Catalog No. ABIN3385055
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PSMC5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 5
NCBI Accession:
NM_002805, NP_002796
Species:
Human
Synonyms:
Psmc5, PSMC5, psmc5, TBP10
Insert length:
1430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Chen, Laurenzana, Coslo, Chen, Omiecinski: "Proteasomal interaction as a critical activity modulator of the human constitutive androstane receptor." in: The Biochemical journal, Vol. 458, Issue 1, pp. 95-107, 2014 (Pubmed)
Catalog No. ABIN3386114
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RBBP9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Retinoblastoma Binding Protein 9
NCBI Accession:
NM_006606, NP_006597
Species:
Human
Synonyms:
RBBP9, rbbp9, Rbbp9
Insert length:
2590 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Shields, Niessen, Murphy, Mielgo, Desgrosellier, Lau, Barnes, Lesperance, Bouvet, Tarin, Cravatt, Cheresh: "RBBP9: a tumor-associated serine hydrolase activity required for pancreatic neoplasia." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 5, pp. 2189-94, 2010 (Pubmed)
Catalog No. ABIN3386291
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PTBP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Polypyrimidine Tract Binding Protein 2
NCBI Accession:
NM_021190, NP_067013
Species:
Human
Synonyms:
PTBP2, LOC100349676, Ptbp2, ptbp2b
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yip, Fuhlbrigge, Taylor, Creusot, Nishikawa-Matsumura, Whiting, Schartner, Akter, von Herrath, Fathman: "Inflammation and hyperglycemia mediate Deaf1 splicing in the pancreatic lymph nodes via distinct pathways during type 1 diabetes." in: Diabetes, Vol. 64, Issue 2, pp. 604-17, 2015 (Pubmed)
Catalog No. ABIN3386141
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RGS4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Regulator of G-Protein Signaling 4
NCBI Accession:
NM_005613, NP_005604
Species:
Human
Synonyms:
RGS4, Rgs4
Insert length:
2740 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Iankova, Chavey, Clapé, Colomer, Guérineau, Grillet, Brunet, Annicotte, Fajas: "Regulator of G protein signaling-4 controls fatty acid and glucose homeostasis." in: Endocrinology, Vol. 149, Issue 11, pp. 5706-12, 2008 (Pubmed)
Catalog No. ABIN3386364
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ring Finger Protein 139
NCBI Accession:
NM_007218, NP_009149
Species:
Human
Synonyms:
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Retinal Pigment Epithelium-Specific Protein 65kDa
NCBI Accession:
NM_000329, NP_000320
Species:
Human
Synonyms:
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC22A2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 22 (Organic Cation Transporter), Member 2
NCBI Accession:
NM_003058, NP_003049
Species:
Human
Synonyms:
OCT2, SLC22A2, Slc22a2
Insert length:
2400 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Sun, Li, Tu, Jiang: "Involvement of organic cation transporter 2 inhibition in potential mechanisms of antidepressant action." in: Progress in neuro-psychopharmacology & biological psychiatry, Vol. 53, Issue , pp. 90-8, 2014 (Pubmed)
  • Sprowl, Ciarimboli, Lancaster, Giovinazzo, Gibson, Du, Janke, Cavaletti, Shields, Sparreboom: "Oxaliplatin-induced neurotoxicity is dependent on the organic cation transporter OCT2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 27, pp. 11199-204, 2013 (Pubmed)
  • Filipski, Loos, Verweij, Sparreboom: "Interaction of Cisplatin with the human organic cation transporter 2." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 12, pp. 3875-80, 2008 (Pubmed)
Catalog No. ABIN3386748
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RRM1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ribonucleotide Reductase M1
NCBI Accession:
NM_001033, NP_001024
Species:
Human
Synonyms:
RRM1, RnrL, rrm1, Rrm1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Xie, Yen, Owonikoko, Ramalingam, Khuri, Curran, Doetsch, Deng: "Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase." in: Cancer research, Vol. 74, Issue 1, pp. 212-23, 2014 (Pubmed)
Catalog No. ABIN3386533
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SMAD, Mothers Against DPP Homolog 1
NCBI Accession:
NM_005900, NP_005891
Species:
Human
Synonyms:
smad1, SMAD1, Mad, Smad1, smad1-a
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Trinh, Barengo, Naora: "Homeodomain protein DLX4 counteracts key transcriptional control mechanisms of the TGF-? cytostatic program and blocks the antiproliferative effect of TGF-?." in: Oncogene, Vol. 30, Issue 24, pp. 2718-29, 2011 (Pubmed)
Catalog No. ABIN3386826
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SMAD Family Member 4
NCBI Accession:
NM_005359, NP_005350
Species:
Human
Synonyms:
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Insert length:
3570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tone, Furuuchi, Kojima, Tykocinski, Greene, Tone: "Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer." in: Nature immunology, Vol. 9, Issue 2, pp. 194-202, 2008 (Pubmed)
Catalog No. ABIN3386828
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGCE is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sarcoglycan, epsilon
NCBI Accession:
NM_003919, NP_003910
Species:
Human
Synonyms:
sgce, SGCE, Sgce
Insert length:
1470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Esapa, Waite, Locke, Benson, Kraus, McIlhinney, Sillitoe, Beesley, Blake: "SGCE missense mutations that cause myoclonus-dystonia syndrome impair epsilon-sarcoglycan trafficking to the plasma membrane: modulation by ubiquitination and torsinA." in: Human molecular genetics, Vol. 16, Issue 3, pp. 327-42, 2007 (Pubmed)
Catalog No. ABIN3386694
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
serum/glucocorticoid Regulated Kinase 1
NCBI Accession:
NM_005627, NP_005618
Species:
Human
Synonyms:
SGK1, Sgk1, sgk1
Insert length:
2560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhong, Oguljahan, Xiao, Nelson, Hernandez, Garcia-Barrio, Francis: "Serum and glucocorticoid-regulated kinase 1 promotes vascular smooth muscle cell proliferation via regulation of β-catenin dynamics." in: Cellular signalling, Vol. 26, Issue 12, pp. 2765-72, 2014 (Pubmed)
  • Chen, Tagliaferro, Kareva, Yarygina, Kholodilov, Burke: "Neurotrophic effects of serum- and glucocorticoid-inducible kinase on adult murine mesencephalic dopamine neurons." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 32, Issue 33, pp. 11299-308, 2012 (Pubmed)
  • Arteaga, Alvarez de la Rosa, Alvarez, Canessa: "Multiple translational isoforms give functional specificity to serum- and glucocorticoid-induced kinase 1." in: Molecular biology of the cell, Vol. 18, Issue 6, pp. 2072-80, 2007 (Pubmed)
Catalog No. ABIN3386695
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SAE1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SUMO1 Activating Enzyme Subunit 1
NCBI Accession:
NM_005500, NP_005491
Species:
Human
Synonyms:
ARHGAP31, SAE1, Sae1, sae1
Insert length:
2050 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kho, Lee, Jeong, Oh, Gorski, Fish, Sanchez, DeVita, Christensen, Dahl, Hajjar: "Small-molecule activation of SERCA2a SUMOylation for the treatment of heart failure." in: Nature communications, Vol. 6, Issue , pp. 7229, 2015 (Pubmed)
Catalog No. ABIN3386574
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...