You are viewing an incomplete version of our website. Please click to reload the website as full version.

Plasmids

A plasmid is a small, circular, double-stranded DNA molecule within a cell that can replicate independently and is not not packaged inside a chromosome . They are common in bacteria and can sometimes be found in archaea or eukaryotic organisms aswell. Plasmid are of great use in biotechnology, they serve as vectors to amplify or express genetic information in foreign hosts. These plasmids will typically contain a multiple cloning site (MCS) to insert the desired sequence, an origin of replication (ORI) to duplicate in the host and selection mechanisms (e.g. antibiotic resistance) to verify the insertion process. The cloning vector is transferred into a robust host (e.g. E.coli) via transformation and greatly amplified within each cell.

Upon lysis the vector can be transferred to an expression vector. They contain an additional promoter sequence which encourage the local transcriptional machinery to transcribe an RNA template in order to produce the protein of interest.

Choose at genomics-online between different types of plasmid inserts. We provide you with ready-to-use shRNA Clones, ORF Clones, cDNA Clones and those specialized on the CRISPR/CAS9 system. For further questions regarding our products, please contact our customer service via phone, live chat, or email.

1,433,380 Products
Data Quality
  • 4
Type
  • 1433380
    Plasmid
Gene
  • 1027
  • 297
  • 281
  • 265
  • 254
Species
  • 529973
  • 511958
  • 280325
  • 27772
  • 24099
Insert
  • 809074
  • 365420
  • 219740
  • 39144
  • 2
Vector
  • 684222
  • 247350
  • 213090
  • 161878
  • 87096
Vector Backbone
  • 149571
  • 81956
  • 62487
  • 62487
  • 62486
Fusion tag
  • 413958
  • 216649
  • 149571
  • 107923
  • 91647
Bacterial Resistance
  • 792543
  • 489942
  • 131424
  • 19805
Selectable Marker
  • 365478
  • 335162
  • 179803
  • 14372
  • 9548
Promoter
  • 433589
  • 264212
  • 254993
  • 247472
  • 149571
Expression Type
  • 806554
  • 496780
  • 3184
Application
  • 684956
  • 485834
  • 365420
  • 39144
Supplier: Log in to see
ISO 9001:2008

Full length Clone DNA of Homo sapiens protease, serine, 8.

Type:
cDNA
Application:
Cloning
Gene:
Protease, serine, 8
NCBI Accession:
NM_002773
Species:
Human
Synonyms:
Prss8, PRSS8
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Bacterial Resistance:
Ampicillin
Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Publications
  • Zhang, Jia, Shi, Ge, Duan, Yang: "PRSS8 is Downregulated and Suppresses Tumour Growth and Metastases in Hepatocellular Carcinoma." in: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, Vol. 40, Issue 3-4, pp. 757-769, 2016 (Pubmed)
Catalog No. ABIN3563885
$137.50
1 vial
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Full length Clone DNA of Mus musculus calreticulin with C terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Calreticulin
NCBI Accession:
NM_007591
Species:
Mouse (Murine)
Synonyms:
calr, crt, CRT, Crc, LmjF31.2600, CALR, Calr, Crt, CRT2, CALR3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Bacterial Resistance:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable
Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Publications
  • Huang, Sun, Wu, Shui, Han, Guo, Li: "Calreticulin Promotes Proliferation and Migration But Inhibits Apoptosis in Schwann Cells." in: Medical science monitor : international medical journal of experimental and clinical research, Vol. 22, Issue , pp. 4516-4522, 2016 (Pubmed)
Catalog No. ABIN3967500
$269.50
1 vial
Will be delivered in 16 to 21 Business Days
Supplier: Log in to see
ISO 9001:2008

Full length Clone DNA of Homo sapiens basigin (Ok blood group) (BSG), transcript variant 2.

Type:
cDNA
Application:
Cloning
Gene:
Basigin (Ok Blood Group)
NCBI Accession:
NM_198589
Species:
Human
Synonyms:
BSG, Bsg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Bacterial Resistance:
Ampicillin
Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Publications
  • Rathore, Dass, Kandari, Kaur, Gupta, Sharma: "Basigin interacts with Plasmodium vivax tryptophan-rich antigen PvTRAg38 as a second erythrocyte receptor to promote parasite growth." in: The Journal of biological chemistry, Vol. , Issue , pp. , 2016 (Pubmed)
Catalog No. ABIN3886420
$104.50
1 vial
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Bad is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death
NCBI Accession:
NM_001285453, NP_001272382
Species:
Mouse (Murine)
Synonyms:
badb, BAD, Bad
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3299717
$250.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NM_001285795, NP_001272724
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
558 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373081
$250.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_001289830, NP_001276759
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
843 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331767
$320.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_001289831, NP_001276760
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
843 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331768
$320.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NM_001286482, NP_001273411
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363145
$330.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NM_001285794, NP_001272723
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373082
$330.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NM_001286483, NP_001273412
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363146
$330.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_001289828, NP_001276757
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
915 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331769
$340.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NM_001286481, NP_001273410
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
894 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363147
$340.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr631 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 631
NCBI Accession:
NM_001271020, NP_001257949
Species:
Mouse (Murine)
Synonyms:
Olfr631, Olr631
Insert length:
960 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334158
$360.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NM_001285792, NP_001272721
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
1065 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373083
$390.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Oprl1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Opiate Receptor-Like 1
NCBI Accession:
NM_001252565, NP_001239494
Species:
Mouse (Murine)
Synonyms:
LOC100051762, OPRL1, oprl1, LOC100335303, Oprl1
Insert length:
1104 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3362986
$400.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Trpc6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Transient Receptor Potential Cation Channel, Subfamily C, Member 6
NCBI Accession:
NM_001282087, NP_001269016
Species:
Mouse (Murine)
Synonyms:
TRPC6, trpc6, Trpc6, trpc6a
Insert length:
1221 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3337885
$440.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Bmf is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Bcl2 Modifying Factor
NCBI Accession:
NM_138313, NP_612186
Species:
Mouse (Murine)
Synonyms:
BMF, bmf, LOC100227756, Bmf, LOC100357766
Insert length:
816 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3293807
$450.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Bcl2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
B-Cell CLL/lymphoma 2
NCBI Accession:
NM_009741, NP_033871
Species:
Mouse (Murine)
Synonyms:
BCL2, LOC100224888, Bcl2, BCL-2, bcl2
Insert length:
711 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3293585
$450.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Dio3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Deiodinase, Iodothyronine, Type III
NCBI Accession:
NM_172119, NP_742117
Species:
Mouse (Murine)
Synonyms:
DIO3, dio3, Dio3
Insert length:
915 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3322908
$450.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Bad is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death
NCBI Accession:
NM_007522, NP_031548
Species:
Mouse (Murine)
Synonyms:
badb, BAD, Bad
Insert length:
615 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3299716
$450.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Sall4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sal-Like 4 (Drosophila)
NCBI Accession:
NM_201396, NP_958798
Species:
Mouse (Murine)
Synonyms:
SALL4, sall4, LOC100230247, Sall4
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3369016
$450.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Evx1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
EVX1
NCBI Accession:
NM_007966, NP_031992
Species:
Mouse (Murine)
Synonyms:
Evx1, EVX1, evx1
Insert length:
1251 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292089
$450.00
1 kit
Will be delivered in 71 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Dlx4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Distal-Less Homeobox 4
NCBI Accession:
NM_007867, NP_031893
Species:
Mouse (Murine)
Synonyms:
DLX4, Dlx4
Insert length:
723 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3290443
$450.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NP_033545
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
1065 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373080
$450.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt7b is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 7B
NCBI Accession:
NM_001163634, NP_001157106
Species:
Mouse (Murine)
Synonyms:
WNT7B, wnt7ba, wnt7b, Wnt7b
Insert length:
1062 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373103
$450.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt10b is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 10B
NCBI Accession:
NM_011718, NP_035848
Species:
Mouse (Murine)
Synonyms:
WNT10B, wnt10b, LOC100351316, Wnt10b
Insert length:
1170 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373078
$450.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 3
NCBI Accession:
NM_009521, NP_033547
Species:
Mouse (Murine)
Synonyms:
WNT3, wnt3, Wnt3
Insert length:
1068 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373090
$450.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Sp5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sp5 Transcription Factor
NCBI Accession:
NM_022435, NP_071880
Species:
Mouse (Murine)
Synonyms:
Sp5, sp5, SP5, CpipJ_CPIJ003609
Insert length:
1197 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3371692
$450.00
1 kit
Will be delivered in 31 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt3a is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 3A
NCBI Accession:
NM_009522, NP_033548
Species:
Mouse (Murine)
Synonyms:
WNT3A, Wnt3a, wnt3a
Insert length:
1059 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376391
$450.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_028016, NP_082292
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
918 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331766
$450.00
1 kit
Will be delivered in 31 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...