
A plasmid is a small, circular, double-stranded DNA molecule within a cell that can replicate independently and is not not packaged inside a chromosome . They are common in bacteria and can sometimes be found in archaea or eukaryotic organisms aswell. Plasmid are of great use in biotechnology, they serve as vectors to amplify or express genetic information in foreign hosts. These plasmids will typically contain a multiple cloning site (MCS) to insert the desired sequence, an origin of replication (ORI) to duplicate in the host and selection mechanisms (e.g. antibiotic resistance) to verify the insertion process. The cloning vector is transferred into a robust host (e.g. E.coli) via transformation and greatly amplified within each cell.

Upon lysis the vector can be transferred to an expression vector. They contain an additional promoter sequence which encourage the local transcriptional machinery to transcribe an RNA template in order to produce the protein of interest.

Choose at genomics-online between different types of plasmid inserts. We provide you with ready-to-use shRNA Clones, ORF Clones, cDNA Clones and those specialized on the CRISPR/CAS9 system. For further questions regarding our products, please contact our customer service via phone, live chat, or email.

1,521,324 Products
Data Quality
  • 3015
  • 1521324
  • 1029
  • 364
  • 336
  • 327
  • 315
  • 685858
  • 481382
  • 334603
  • 6494
  • 3604
  • 585859
  • 412142
  • 215850
  • 154617
  • 114972
  • 660702
  • 413396
  • 247252
  • 161881
  • 22625
Vector Backbone
  • 115473
  • 114972
  • 108734
  • 62463
  • 62462
Fusion tag
  • 413695
  • 216580
  • 183642
  • 135728
  • 91625
Resistance Gene
  • 822973
  • 485157
  • 191902
  • 37846
  • 21292
Selectable Marker
  • 484802
  • 369172
  • 179829
  • 7154
  • 485442
  • 449901
  • 301934
  • 264116
  • 153319
Expression Type
  • 1049216
  • 552687
  • 433993
  • 950615
  • 307435
  • 277841
  • 215850
  • 29
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPHK1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Sphingosine Kinase 1 (SPHK1)
NCBI Accession:
Sk1, SPHK1, sphk1, LOC100357790, Sphk1
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Jiang, Smith, Li, Rao, Liu, Donahue, Wang, Turner: "Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation." in: American journal of physiology. Cell physiology, Vol. 304, Issue 12, pp. C1187-97, 2013 (Pubmed)
  • Antoon, White, Driver, Burow, Beckman: "Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer." in: Experimental biology and medicine (Maywood, N.J.), Vol. 237, Issue 7, pp. 832-44, 2012 (Pubmed)
Catalog No. ABIN3318318
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.

Protein Expression
SRY (Sex Determining Region Y)-Box 9 (SOX9)
NCBI Accession:
SOX9, LOC100227849, SOX10, Sox9
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Luanpitpong, Li, Manke, Brundage, Ellis, McLaughlin, Angsutararux, Chanthra, Voronkova, Chen, Wang, Chanvorachote, Pei, Issaragrisil, Rojanasakul: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, 2016 (Pubmed)
  • Shakhova, Cheng, Mishra, Zingg, Schaefer, Debbache, Häusel, Matter, Guo, Davis, Meltzer, Mihic-Probst, Moch, Wegner, Merlino, Levesque, Dummer, Santoro, Cinelli, Sommer: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, 2015 (Pubmed)
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Matsushima, Kuroki, Kitasato, Adachi, Tanaka, Hirabaru, Hirayama, Kuroshima, Hidaka, Soyama, Takatsuki, Kinoshita, Sano, Nishida, Eguchi: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, 2015 (Pubmed)
  • Bobick, Alexander, Tuan: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, 2014 (Pubmed)
  • Needham, Shah, Dahlin, Kinard, Lam, Watson, Lu, Kasper, Mikos: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, 2014 (Pubmed)
  • Mata-Rocha, Hernández-Sánchez, Guarneros, de la Chesnaye, Sánchez-Tusié, Treviño, Felix, Oviedo: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, 2014 (Pubmed)
  • Show more References
Catalog No. ABIN3319363
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF5 is ideal for over-expression of native protein for functional studies.

Protein Expression
Kruppel-Like Factor 5 (Intestinal) (KLF5)
NCBI Accession:
KLF5, LOC100231095, klf5, Klf5
Insert length:
1700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yang, Nakagawa, Tetreault, Billig, Victor, Goyal, Sepulveda, Katz: "Loss of transcription factor KLF5 in the context of p53 ablation drives invasive progression of human squamous cell cancer." in: Cancer research, Vol. 71, Issue 20, pp. 6475-84, 2011 (Pubmed)
Catalog No. ABIN3317771
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human UCP2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Uncoupling Protein 2 (Mitochondrial, Proton Carrier) (UCP2)
NCBI Accession:
PTRG_09289, UCP2, LOC100282746, ucp2, TEgg068n20.1, LOC100534553, Ucp2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Fiorini, Cordani, Gotte, Picone, Donadelli: "Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner." in: Biochimica et biophysica acta, Vol. 1853, Issue 3, pp. 549-60, 2015 (Pubmed)
Catalog No. ABIN3318600
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EFEMP2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Fibulin 4 (FBLN4)
NCBI Accession:
Efemp2, efemp2b, fbln4, EFEMP2
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • McLaughlin, Chen, Horiguchi, Starcher, Stanton, Broekelmann, Marmorstein, McKay, Mecham, Nakamura, Marmorstein: "Targeted disruption of fibulin-4 abolishes elastogenesis and causes perinatal lethality in mice." in: Molecular and cellular biology, Vol. 26, Issue 5, pp. 1700-9, 2006 (Pubmed)
Catalog No. ABIN3377844
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human AMFR is ideal for over-expression of native protein for functional studies.

Protein Expression
Autocrine Motility Factor Receptor (AMFR)
NCBI Accession:
AMFR, amfr, AaeL_AAEL005881, CpipJ_CPIJ016043, Smp_150210.2, Smp_047420, Amfr
Insert length:
3500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3377002
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EXOC2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Exocyst Complex Component 2 (EXOC2)
NCBI Accession:
sec5, EXOC2, LOC100226726, Exoc2, SEC5A, sec-5
Insert length:
4700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Simicek, Lievens, Laga, Guzenko, Aushev, Kalev, Baietti, Strelkov, Gevaert, Tavernier, Sablina: "The deubiquitylase USP33 discriminates between RALB functions in autophagy and innate immune response." in: Nature cell biology, Vol. 15, Issue 10, pp. 1220-30, 2013 (Pubmed)
Catalog No. ABIN3377943
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACSF2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Acyl-CoA Synthetase Family Member 2 (ACSF2)
NCBI Accession:
ACSF2, Acsf2, acsf2
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Watkins, Maiguel, Jia, Pevsner: "Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome." in: Journal of lipid research, Vol. 48, Issue 12, pp. 2736-50, 2007 (Pubmed)
Catalog No. ABIN3376894
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DFFB is ideal for over-expression of native protein for functional studies.

Protein Expression
DNA Fragmentation Factor, 40kDa, beta Polypeptide (Caspase-Activated DNase) (DFFB)
NCBI Accession:
DFFB, LOC100223514, Dffb
Insert length:
3340 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yoon, Park, Han, Kang, Kim, Lee, Park, Shin, Kim, Yun, Chwae: "Caspase-dependent cell death-associated release of nucleosome and damage-associated molecular patterns." in: Cell death & disease, Vol. 5, Issue , pp. e1494, 2014 (Pubmed)
Catalog No. ABIN3377730
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human FES is ideal for over-expression of native protein for functional studies.

Protein Expression
Feline Sarcoma Oncogene (FES)
NCBI Accession:
FES, fes, Fes
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ye, Kantonen, Henkels, Gomez-Cambronero: "A new signaling pathway (JAK-Fes-phospholipase D) that is enhanced in highly proliferative breast cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 14, pp. 9881-91, 2013 (Pubmed)
  • Loriaux, Levine, Tyner, Fröhling, Scholl, Stoffregen, Wernig, Erickson, Eide, Berger, Bernard, Griffin, Stone, Lee, Meyerson, Heinrich, Deininger, Gilliland, Druker: "High-throughput sequence analysis of the tyrosine kinome in acute myeloid leukemia." in: Blood, Vol. 111, Issue 9, pp. 4788-96, 2008 (Pubmed)
Catalog No. ABIN3378040
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CYP1A1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Cytochrome P450, Family 1, Subfamily A, Polypeptide 1 (CYP1A1)
NCBI Accession:
CYP1A1, CYPIA1, CpipJ_CPIJ010542, cyp1a1, Cyp1a1, LOC100328613
Insert length:
2310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Kekatpure, Dannenberg, Subbaramaiah: "HDAC6 modulates Hsp90 chaperone activity and regulates activation of aryl hydrocarbon receptor signaling." in: The Journal of biological chemistry, Vol. 284, Issue 12, pp. 7436-45, 2009 (Pubmed)
Catalog No. ABIN3377645
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BCL2L1 is ideal for over-expression of native protein for functional studies.

Protein Expression
BCL2-Like 1 (BCL2L1)
NCBI Accession:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
2380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Fouqué, Lepvrier, Debure, Gouriou, Malleter, Delcroix, Ovize, Ducret, Li, Hammadi, Vacher, Legembre: "The apoptotic members CD95, BclxL, and Bcl-2 cooperate to promote cell migration by inducing Ca(2+) flux from the endoplasmic reticulum to mitochondria." in: Cell death and differentiation, Vol. 23, Issue 10, pp. 1702-16, 2016 (Pubmed)
Catalog No. ABIN3382739
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GABRA1 is ideal for over-expression of native protein for functional studies.

Protein Expression
gamma-aminobutyric Acid (GABA) A Receptor, alpha 1 (GABRA1)
NCBI Accession:
GABRA1, Gabra1, gabra1
Insert length:
2290 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ariño, Höftberger, Gresa-Arribas, Martínez-Hernández, Armangue, Kruer, Arpa, Domingo, Rojc, Bataller, Saiz, Dalmau, Graus: "Paraneoplastic Neurological Syndromes and Glutamic Acid Decarboxylase Antibodies." in: JAMA neurology, Vol. 72, Issue 8, pp. 874-81, 2015 (Pubmed)
  • Hendriks, van Kleef, van den Berg, Westerink: "Multiple novel modes of action involved in the in vitro neurotoxic effects of tetrabromobisphenol-A." in: Toxicological sciences : an official journal of the Society of Toxicology, Vol. 128, Issue 1, pp. 235-46, 2012 (Pubmed)
Catalog No. ABIN3384155
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human HEY1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ha-Ry/enhancer-of-Split Related with YRPW Motif 1 (HEY1)
NCBI Accession:
HEY1, Hey1, hey1
Insert length:
1310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Giacopelli, Cappato, Tonachini, Mura, Di Lascio, Fornasari, Ravazzolo, Bocciardi: "Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva." in: Orphanet journal of rare diseases, Vol. 8, Issue , pp. 145, 2013 (Pubmed)
Catalog No. ABIN3384403
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human HLCS is ideal for over-expression of native protein for functional studies.

Protein Expression
Biotin-Protein Ligase (HLCS)
NCBI Accession:
Hlcs, HLCS
Insert length:
3100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ingaramo, Beckett: "Distinct amino termini of two human HCS isoforms influence biotin acceptor substrate recognition." in: The Journal of biological chemistry, Vol. 284, Issue 45, pp. 30862-70, 2009 (Pubmed)
Catalog No. ABIN3384448
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human HNRPDL is ideal for over-expression of native protein for functional studies.

Protein Expression
Heterogeneous Nuclear Ribonucleoprotein D-Like (HNRPDL)
NCBI Accession:
hnrpdl, hnrnpdl, HNRPDL, HNRNPDL, Hnrnpdl1, Hnrnpdl, LOC690144, LOC100351670, LOC101120922
Insert length:
2470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3384492
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DDX21 is ideal for over-expression of native protein for functional studies.

Protein Expression
DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 21 (DDX21)
NCBI Accession:
ddx21, DDX21, Ddx21
Insert length:
3410 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3383610
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DKC1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Dyskeratosis Congenita 1, Dyskerin (DKC1)
NCBI Accession:
DKC1, dkc1, LOC100340288, Dkc1, NAP57
Insert length:
2450 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Moye, Porter, Cohen, Phan, Zyner, Sasaki, Lovrecz, Beck, Bryan: "Telomeric G-quadruplexes are a substrate and site of localization for human telomerase." in: Nature communications, Vol. 6, Issue , pp. 7643, 2015 (Pubmed)
  • Agarwal, Loh, McLoughlin, Huang, Park, Miller, Huo, Okuka, Dos Reis, Loewer, Ng, Keefe, Goldman, Klingelhutz, Liu, Daley: "Telomere elongation in induced pluripotent stem cells from dyskeratosis congenita patients." in: Nature, Vol. 464, Issue 7286, pp. 292-6, 2010 (Pubmed)
Catalog No. ABIN3383663
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GLI1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Zinc Finger Protein GLI1 (GLI1)
NCBI Accession:
GLI1, Gli1, gli1
Insert length:
3600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Calvisi, Pinna, Ladu, Pellegrino, Simile, Frau, De Miglio, Tomasi, Sanna, Muroni, Feo, Pascale: "Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC." in: Gut, Vol. 58, Issue 5, pp. 679-87, 2009 (Pubmed)
Catalog No. ABIN3384227
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NET1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Neuroepithelial Cell Transforming 1 (NET1)
NCBI Accession:
net1, EDI_348570, NET1, Net1
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • García-Mata, Dubash, Sharek, Carr, Frost, Burridge: "The nuclear RhoA exchange factor Net1 interacts with proteins of the Dlg family, affects their localization, and influences their tumor suppressor activity." in: Molecular and cellular biology, Vol. 27, Issue 24, pp. 8683-97, 2007 (Pubmed)
Catalog No. ABIN3385420
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...