Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

38 Products
Type
  • 38
    Plasmid
Insert
  • 585859
  • 423482
  • 215850
  • 154617
  • 114972
Vector
  • 34
  • 3
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 18
  • 4
  • 3
  • 3
  • 3
Resistance Gene
  • 20
  • 17
  • 1
Selectable Marker
  • 26
  • 5
  • 3
Promoter
  • 27
  • 7
  • 4
  • 3
  • 1
Expression Type
  • 37
  • 32
  • 1
Application
  • 29
  • 26
  • 10
  • 7
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (HA-tagged)

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948153
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948154
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (Myc-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948155
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948157
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948159
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948158
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948160
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Contol Vector (untagged)

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948152
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (FLAG-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948156
$115.50
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

shRNA RFP Cloning Vector (pRFP-C-RS Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948188
$198.94
5 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

shRNA GFP Cloning Vector (pGFP-V-RS Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948187
$198.94
5 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV6-AC-Myc-DDK, mammalian vector with C-terminal Myc-DDK tag

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948180
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-Neo, circular and NotI-digested / dephosphorylated vector

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948182
$375.78
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV6-AC, mammalian vector with non-tagged expression

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948179
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948181
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCAS-Guide vector (with Cas9 expression) for genomic target sequence cloning

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948178
$497.36
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

shRNA pRS Cloning Vector

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948189
$198.94
5 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL4 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948183
$375.78
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL6 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948185
$375.78
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Blank-Control Bacterial expression Vector

Type:
Empty
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-Blank
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Expression:
Transient
Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372073
$85.00
500 ng
Plus shipping costs $45.00
Will be delivered in 11 to 21 Business Days
  • <
  • 1