Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

40 Products
  • 40
  • 585860
  • 397475
  • 215849
  • 154617
  • 114972
  • 35
  • 3
  • 1
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 19
  • 4
  • 3
  • 3
  • 3
Resistance Gene
  • 20
  • 18
  • 2
Selectable Marker
  • 26
  • 5
  • 4
  • 27
  • 8
  • 5
  • 4
  • 1
Expression Type
  • 39
  • 33
  • 1
  • 31
  • 26
  • 12
  • 7
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (HA-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948153
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948158
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948159
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948154
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (FLAG-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948156
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Contol Vector (untagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948152
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (Myc-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948155
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948157
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948160
10 μg
Plus shipping costs $45.00 Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

shRNA GFP Cloning Vector (pGFP-V-RS Vector)

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable
4 °C/-20 °C
Catalog No. ABIN4948187
5 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

shRNA RFP Cloning Vector (pRFP-C-RS Vector)

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
RFP tag
Transient, Stable
4 °C/-20 °C
Catalog No. ABIN4948188
5 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV6-AC-Myc-DDK, mammalian vector with C-terminal Myc-DDK tag

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948180
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

shRNA GFP Lenti Cloning Vector (pGFP-C-shLenti Vector)

Negative Control, Cloning
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable
4 °C/-20 °C
Catalog No. ABIN4948186
5 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-Neo, circular and NotI-digested / dephosphorylated vector

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter, T7 Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948182
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948181
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV6-AC, mammalian vector with non-tagged expression

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948179
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCAS-Guide vector (with Cas9 expression) for genomic target sequence cloning

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
U6 Promoter, Enhanced CMV Promoter
Sequencing Primer:
4 °C/-20 °C
Catalog No. ABIN4948178
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

shRNA pRS Cloning Vector

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Transient, Stable
4 °C/-20 °C
Catalog No. ABIN4948189
5 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL4 as negative control

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948183
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL6 as negative control

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, SP6 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948185
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
  • <
  • 1