You are viewing an incomplete version of our website. Please click to reload the website as full version.

Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

40 Products
  • 40
  • 785868
  • 365420
  • 249950
  • 39144
  • 37846
  • 35
  • 3
  • 1
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 19
  • 4
  • 3
  • 3
  • 3
Bacterial Resistance
  • 20
  • 18
  • 2
Selectable Marker
  • 26
  • 5
  • 4
  • 27
  • 8
  • 5
  • 4
  • 1
Expression Type
  • 39
  • 33
  • 1
  • 31
  • 26
  • 12
  • 7
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (HA-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948153
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (FLAG-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948156
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948157
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948160
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948159
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948158
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948154
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Contol Vector (untagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948152
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (Myc-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948155
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

shRNA GFP Cloning Vector (pGFP-V-RS Vector)

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
4 °C/-20 °C
Catalog No. ABIN4948187
5 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA RFP Cloning Vector (pRFP-C-RS Vector)

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
U6 Promoter
Fusion Tag:
RFP tag
4 °C/-20 °C
Catalog No. ABIN4948188
5 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-AC-Myc-DDK, mammalian vector with C-terminal Myc-DDK tag

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948180
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA GFP Lenti Cloning Vector (pGFP-C-shLenti Vector)

Negative Control, Cloning
Vector type:
Lentiviral Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
4 °C/-20 °C
Catalog No. ABIN4948186
5 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-Neo, circular and NotI-digested / dephosphorylated vector

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948182
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-AC, mammalian vector with non-tagged expression

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
Enhanced CMV Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948179
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
Enhanced CMV Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948181
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCAS-Guide vector (with Cas9 expression) for genomic target sequence cloning

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
U6 Promoter,Enhanced CMV Promoter
Sequencing Primer:
4 °C/-20 °C
Catalog No. ABIN4948178
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA pRS Cloning Vector

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
U6 Promoter
4 °C/-20 °C
Catalog No. ABIN4948189
5 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL4 as negative control

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948183
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL5 as negative control

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948184
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL6 as negative control

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,SP6 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948185
10 μg
Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Blank-Control Bacterial expression Vector

Vector type:
Bacterial Expression Vector
Vector backbone:
Bacterial Resistance:
T7 Promoter
Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372073
500 ng
Will be delivered in 11 to 21 Business Days
Supplier: Log in to see

Blank-Control Mammalian expression Vector

Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372074
500 ng
Will be delivered in 11 to 21 Business Days
Supplier: Log in to see

pCMV3-C-HA Negative Control Vector (C-terminal HA-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948163
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV3-C-FLAG Negative Control Vector (C-terminal FLAG-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948162
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
MYC tag
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948164
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV3-N-Myc Negative Control Vector (N-terminal Myc-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
MYC tag
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948168
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV3-N-FLAG Negative Control Vector (N-terminal FLAG-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948166
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV3-C-His Negative Control Vector (C-terminal His-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948165
10 μg
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV3-N-HA Negative Control Vector (N-terminal HA-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948167
10 μg
Will be delivered in 7 to 8 Business Days
  • <
  • 1