You are viewing an incomplete version of our website. Please click to reload the website as full version.

Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

48 Products
Type
  • 48
    Plasmid
Insert
  • 785888
  • 365420
  • 265062
  • 154627
  • 114974
Vector
  • 35
  • 9
  • 3
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 23
  • 4
  • 3
  • 3
  • 3
Bacterial Resistance
  • 26
  • 20
  • 2
Selectable Marker
  • 26
  • 6
  • 5
  • 1
Promoter
  • 27
  • 8
  • 5
  • 4
  • 1
Expression Type
  • 47
  • 38
  • 1
Application
  • 31
  • 26
  • 20
  • 8
  • 7
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (HA-tagged)

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable
Empty Vector:
ABIN4948157
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948153
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (FLAG-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948160
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948156
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948153
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948157
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948156
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948160
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948155
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948159
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948154
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948158
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948158
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948154
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Contol Vector (untagged)

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948152
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (Myc-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Bacterial Resistance:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Empty Vector:
ABIN4948159
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948155
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

shRNA GFP Cloning Vector (pGFP-V-RS Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Bacterial Resistance:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948187
$198.94
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA RFP Cloning Vector (pRFP-C-RS Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Bacterial Resistance:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948188
$198.94
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-AC-Myc-DDK, mammalian vector with C-terminal Myc-DDK tag

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948180
$420.00
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA GFP Lenti Cloning Vector (pGFP-C-shLenti Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Lentiviral Vector
Vector backbone:
pGFP-C-shLenti
Bacterial Resistance:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948186
$442.10
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-Neo, circular and NotI-digested / dephosphorylated vector

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Neo
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948182
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-AC, mammalian vector with non-tagged expression

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948179
$420.00
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948181
$420.00
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCAS-Guide vector (with Cas9 expression) for genomic target sequence cloning

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948178
$508.42
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA pRS Cloning Vector

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRS
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948189
$198.94
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL4 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948183
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL5 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948184
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL6 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,SP6 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948185
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-ZsGreen)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-EFS-ZsGreen
Bacterial Resistance:
Ampicillin
Fusion Tag:
ZsGreen
Expression:
Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074757
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-tRFP)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-EFS-tRFP
Bacterial Resistance:
Ampicillin
Fusion Tag:
RFP tag
Expression:
Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074758
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-ZsGreen)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-hCMV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Fusion Tag:
ZsGreen
Expression:
Stable,Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074769
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-tRFP)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-hCMV-tRFP
Bacterial Resistance:
Ampicillin
Fusion Tag:
RFP tag
Expression:
Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074770
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-Puro)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-EFS-Puro
Bacterial Resistance:
Ampicillin
Expression:
Stable,Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074755
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-Blast)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-EFS-Blast
Bacterial Resistance:
Ampicillin
Expression:
Stable,Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074756
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-Puro)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-hCMV-Puro
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Expression:
Stable,Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074767
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-Blast)

Type:
Empty
Application:
Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-All-hCMV-Blast
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Expression:
Stable,Transient
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5074768
$690.00
1 vial
Plus shipping costs $45.00 Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

Blank-Control Bacterial expression Vector

Type:
Empty
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-Blank
Bacterial Resistance:
Kanamycin
Promoter:
T7 Promoter
Expression:
Transient
Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372073
$85.00
500 ng
Plus shipping costs $45.00 Will be delivered in 11 to 21 Business Days
  • <
  • 1