You are viewing an incomplete version of our website. Please click to reload the website as full version.

Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

48 Products
Type
  • 48
    Plasmid
Insert
  • 785884
  • 437354
  • 365420
  • 154625
  • 114972
Vector
  • 35
  • 9
  • 3
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 23
  • 4
  • 3
  • 3
  • 3
Resistance Gene
  • 26
  • 20
  • 2
Selectable Marker
  • 26
  • 6
  • 5
  • 1
Promoter
  • 27
  • 8
  • 5
  • 4
  • 1
Expression Type
  • 47
  • 38
  • 1
Application
  • 31
  • 26
  • 20
  • 8
  • 7
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (HA-tagged)

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948153
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (FLAG-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948156
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948157
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948160
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948159
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948158
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948154
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Contol Vector (untagged)

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948152
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (Myc-tagged)

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948155
$115.50
10 μg
Plus shipping costs $45.00 Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

shRNA GFP Cloning Vector (pGFP-V-RS Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948187
$198.94
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA RFP Cloning Vector (pRFP-C-RS Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948188
$198.94
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-AC-Myc-DDK, mammalian vector with C-terminal Myc-DDK tag

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948180
$420.00
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

shRNA GFP Lenti Cloning Vector (pGFP-C-shLenti Vector)

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Lentiviral Vector
Vector backbone:
pGFP-C-shLenti
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948186
$442.10
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-Neo, circular and NotI-digested / dephosphorylated vector

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948182
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-AC, mammalian vector with non-tagged expression

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948179
$420.00
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948181
$420.00
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

pCAS-Guide vector (with Cas9 expression) for genomic target sequence cloning

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948178
$497.36
10 μg
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

shRNA pRS Cloning Vector

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient,Stable
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948189
$198.94
5 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL4 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948183
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL5 as negative control

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948184
$375.78
10 μg
Plus shipping costs $45.00 Will be delivered in 9 to 11 Business Days
  • <
  • 1